Incidental Mutation 'R7406:Vwa3a'
ID574740
Institutional Source Beutler Lab
Gene Symbol Vwa3a
Ensembl Gene ENSMUSG00000030889
Gene Namevon Willebrand factor A domain containing 3A
SynonymsE030013G06Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7406 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location120739318-120805742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120778915 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 476 (I476N)
Ref Sequence ENSEMBL: ENSMUSP00000133029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033180] [ENSMUST00000165055] [ENSMUST00000166668] [ENSMUST00000167213] [ENSMUST00000168600]
Predicted Effect probably damaging
Transcript: ENSMUST00000033180
AA Change: I476N

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000033180
Gene: ENSMUSG00000030889
AA Change: I476N

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 6.3e-30 PFAM
Pfam:VWA_3 483 634 1.2e-17 PFAM
VWA 921 1092 1.89e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165055
SMART Domains Protein: ENSMUSP00000129672
Gene: ENSMUSG00000030889

DomainStartEndE-ValueType
Blast:VWA 1 162 1e-94 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000166668
AA Change: I476N

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129136
Gene: ENSMUSG00000030889
AA Change: I476N

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 1.3e-28 PFAM
Pfam:VWA_3 483 633 5.2e-17 PFAM
VWA 921 1092 1.89e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167213
AA Change: I476N

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133029
Gene: ENSMUSG00000030889
AA Change: I476N

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 1.3e-28 PFAM
Pfam:VWA_3 483 633 5.2e-17 PFAM
VWA 921 1092 1.89e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168600
AA Change: I476N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132372
Gene: ENSMUSG00000030889
AA Change: I476N

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 8.3e-29 PFAM
Pfam:VWA_3 483 609 5.3e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207721
Meta Mutation Damage Score 0.7813 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T C 1: 86,046,509 S183P possibly damaging Het
2900092C05Rik A G 7: 12,515,464 T75A possibly damaging Het
Abhd8 A G 8: 71,461,762 V74A probably benign Het
Agrn A C 4: 156,172,301 S1282R possibly damaging Het
Atf5 T C 7: 44,812,956 N248S possibly damaging Het
Atp2a3 A G 11: 72,978,750 Y497C probably damaging Het
BC053393 A G 11: 46,577,458 T120A possibly damaging Het
Bpifa2 T G 2: 154,009,819 S58R probably benign Het
Cacna1h C T 17: 25,385,626 E1238K possibly damaging Het
Ccdc71 T A 9: 108,463,324 L112* probably null Het
Cd300e A T 11: 115,055,302 I111N probably damaging Het
Cdkl3 A T 11: 52,033,542 E552D probably benign Het
Chst5 A G 8: 111,890,613 V125A probably benign Het
Clock A T 5: 76,266,845 M1K probably null Het
Cops7b T A 1: 86,601,130 L193Q probably benign Het
Csmd1 T C 8: 16,288,693 T467A probably damaging Het
Ctr9 A G 7: 111,053,408 E971G unknown Het
Dcp2 A G 18: 44,410,187 T271A probably benign Het
Dsp A G 13: 38,197,196 N2639S possibly damaging Het
Fam160a1 T C 3: 85,730,477 I172V probably benign Het
Gpr179 G T 11: 97,351,594 D141E probably damaging Het
Hist1h2bc A G 13: 23,684,359 Y43C probably damaging Het
Krt6b T G 15: 101,679,078 T194P probably benign Het
Lrp1b T C 2: 41,376,018 probably null Het
Maneal A T 4: 124,860,368 I214N possibly damaging Het
Map1lc3b T A 8: 121,590,616 C11S unknown Het
Mapt G A 11: 104,322,524 G296E possibly damaging Het
Mettl7a3 T C 15: 100,335,408 V160A probably benign Het
Mgam A G 6: 40,663,525 N509S probably benign Het
Mrgprx1 T A 7: 48,021,985 I5F possibly damaging Het
Mroh5 T C 15: 73,787,734 D416G probably benign Het
Ncan T G 8: 70,110,099 D503A probably benign Het
Ogdh A G 11: 6,348,351 T641A probably benign Het
Olfr11 T C 13: 21,639,146 I126V probably benign Het
Olfr730 T A 14: 50,186,558 I221F probably damaging Het
Olfr818 A T 10: 129,945,566 D50E probably benign Het
Olfr904 T A 9: 38,464,143 M34K possibly damaging Het
Pcdhga8 A C 18: 37,726,185 Q98P possibly damaging Het
Pik3c2a A G 7: 116,354,007 Y1218H probably damaging Het
Ppp3cc A T 14: 70,245,938 S229T possibly damaging Het
Prss43 T G 9: 110,828,696 I221S probably damaging Het
Rasal1 A T 5: 120,662,937 T221S probably benign Het
Serpinb9f G T 13: 33,334,560 E348* probably null Het
Sfxn5 A G 6: 85,267,907 Y169H probably damaging Het
Skint9 T C 4: 112,389,231 N228S probably benign Het
Slx4ip A T 2: 137,000,242 D29V probably damaging Het
Snx29 G T 16: 11,755,316 G474V probably damaging Het
Spata6 T A 4: 111,780,820 D282E possibly damaging Het
Srek1 A T 13: 103,769,382 V77E probably damaging Het
Tnfrsf22 T C 7: 143,640,827 D121G probably damaging Het
Ucma G A 2: 4,985,359 W122* probably null Het
Vmn2r54 A T 7: 12,616,223 probably null Het
Vmn2r8 A G 5: 108,800,576 L482S probably benign Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdr26 A T 1: 181,187,675 S390R probably damaging Het
Zbtb40 A T 4: 137,000,894 S471T probably benign Het
Other mutations in Vwa3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Vwa3a APN 7 120783974 missense probably benign 0.09
IGL01807:Vwa3a APN 7 120775506 splice site probably null
IGL02850:Vwa3a APN 7 120773292 missense probably benign 0.00
IGL03253:Vwa3a APN 7 120778869 missense probably benign 0.03
PIT4812001:Vwa3a UTSW 7 120776133 missense probably damaging 1.00
R0026:Vwa3a UTSW 7 120780211 missense probably damaging 1.00
R0114:Vwa3a UTSW 7 120775380 missense probably benign 0.06
R1145:Vwa3a UTSW 7 120793343 missense probably damaging 0.99
R1145:Vwa3a UTSW 7 120793343 missense probably damaging 0.99
R1306:Vwa3a UTSW 7 120800390 missense possibly damaging 0.49
R1355:Vwa3a UTSW 7 120784111 missense probably damaging 1.00
R1412:Vwa3a UTSW 7 120780154 missense probably damaging 1.00
R1466:Vwa3a UTSW 7 120768165 missense probably damaging 1.00
R1466:Vwa3a UTSW 7 120768165 missense probably damaging 1.00
R1584:Vwa3a UTSW 7 120768165 missense probably damaging 1.00
R1686:Vwa3a UTSW 7 120780148 missense probably damaging 1.00
R1710:Vwa3a UTSW 7 120804031 splice site probably null
R1717:Vwa3a UTSW 7 120793386 missense probably benign
R1834:Vwa3a UTSW 7 120790136 missense probably benign 0.06
R1912:Vwa3a UTSW 7 120795627 missense probably damaging 1.00
R1970:Vwa3a UTSW 7 120780171 missense probably damaging 1.00
R1978:Vwa3a UTSW 7 120758954 missense probably null 0.00
R2034:Vwa3a UTSW 7 120782645 nonsense probably null
R2059:Vwa3a UTSW 7 120758949 missense probably damaging 0.98
R2120:Vwa3a UTSW 7 120792418 missense probably benign
R2408:Vwa3a UTSW 7 120773294 missense probably benign 0.00
R3423:Vwa3a UTSW 7 120799111 missense probably damaging 1.00
R3744:Vwa3a UTSW 7 120752594 missense probably benign
R3816:Vwa3a UTSW 7 120800379 missense probably benign 0.29
R3849:Vwa3a UTSW 7 120762464 nonsense probably null
R3904:Vwa3a UTSW 7 120758876 missense probably benign
R4031:Vwa3a UTSW 7 120768232 critical splice donor site probably null
R4408:Vwa3a UTSW 7 120778926 missense probably benign 0.16
R4628:Vwa3a UTSW 7 120793375 missense probably benign 0.05
R4629:Vwa3a UTSW 7 120793375 missense probably benign 0.05
R4652:Vwa3a UTSW 7 120778915 missense probably damaging 0.96
R4884:Vwa3a UTSW 7 120791701 missense probably benign
R4948:Vwa3a UTSW 7 120776264 missense probably damaging 0.98
R5112:Vwa3a UTSW 7 120783985 missense probably damaging 1.00
R5385:Vwa3a UTSW 7 120790142 missense possibly damaging 0.91
R5386:Vwa3a UTSW 7 120790142 missense possibly damaging 0.91
R5579:Vwa3a UTSW 7 120768173 missense probably benign 0.29
R5587:Vwa3a UTSW 7 120780235 missense probably damaging 1.00
R5639:Vwa3a UTSW 7 120790143 missense probably damaging 0.99
R6102:Vwa3a UTSW 7 120776138 splice site probably null
R6239:Vwa3a UTSW 7 120794234 missense probably benign 0.00
R6279:Vwa3a UTSW 7 120782400 missense probably damaging 0.98
R6298:Vwa3a UTSW 7 120795651 missense probably benign 0.01
R6300:Vwa3a UTSW 7 120782400 missense probably damaging 0.98
R6336:Vwa3a UTSW 7 120762423 missense possibly damaging 0.93
R6907:Vwa3a UTSW 7 120792581 unclassified probably benign
R7135:Vwa3a UTSW 7 120773030 missense possibly damaging 0.69
R7215:Vwa3a UTSW 7 120795630 missense possibly damaging 0.83
R7282:Vwa3a UTSW 7 120786465 missense probably benign 0.03
R7351:Vwa3a UTSW 7 120776336 missense probably damaging 0.99
R7557:Vwa3a UTSW 7 120795618 missense possibly damaging 0.90
R7612:Vwa3a UTSW 7 120752615 missense probably null 0.47
V7732:Vwa3a UTSW 7 120778949 splice site probably benign
X0019:Vwa3a UTSW 7 120768209 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATGGACTTGCATCTTCCCTAAC -3'
(R):5'- TCTGTTGCTTCTAACTCAAAGAGTC -3'

Sequencing Primer
(F):5'- CCTGTATAAACCATTTCCAGAAGCTG -3'
(R):5'- GCTTCTAACTCAAAGAGTCTTGAGAG -3'
Posted On2019-10-07