Incidental Mutation 'R7437:Fam213b'
ID576664
Institutional Source Beutler Lab
Gene Symbol Fam213b
Ensembl Gene ENSMUSG00000029059
Gene Namefamily with sequence similarity 213, member B
SynonymsPM/PGFS, 2810405K02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7437 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location154895504-154899135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 154896596 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 194 (C194F)
Ref Sequence ENSEMBL: ENSMUSP00000030935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030935] [ENSMUST00000079269] [ENSMUST00000080559] [ENSMUST00000105634] [ENSMUST00000105635] [ENSMUST00000132281] [ENSMUST00000163732]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030935
AA Change: C194F

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030935
Gene: ENSMUSG00000029059
AA Change: C194F

DomainStartEndE-ValueType
Pfam:AhpC-TSA_2 53 166 9.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079269
SMART Domains Protein: ENSMUSP00000078252
Gene: ENSMUSG00000058183

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 99 498 1.7e-135 PFAM
Pfam:Peptidase_M13 559 767 1.2e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080559
SMART Domains Protein: ENSMUSP00000079399
Gene: ENSMUSG00000058183

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 76 512 4.8e-131 PFAM
Pfam:Peptidase_M13 573 779 3.4e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105634
SMART Domains Protein: ENSMUSP00000101259
Gene: ENSMUSG00000058183

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 76 512 1.4e-105 PFAM
Pfam:Peptidase_M13 573 781 4e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105635
SMART Domains Protein: ENSMUSP00000101260
Gene: ENSMUSG00000058183

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 76 475 1.6e-135 PFAM
Pfam:Peptidase_M13 536 744 1.2e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132281
SMART Domains Protein: ENSMUSP00000116611
Gene: ENSMUSG00000029059

DomainStartEndE-ValueType
Pfam:AhpC-TSA_2 9 114 4.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163732
SMART Domains Protein: ENSMUSP00000131753
Gene: ENSMUSG00000058183

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 99 498 1.7e-135 PFAM
Pfam:Peptidase_M13 559 765 3.3e-71 PFAM
Meta Mutation Damage Score 0.3716 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,400,498 I1192F probably damaging Het
Abca8a A G 11: 110,050,964 S1160P probably benign Het
Adamtsl2 A G 2: 27,089,709 I297V probably damaging Het
Aebp1 T A 11: 5,869,757 F687L possibly damaging Het
Ahsa1 A G 12: 87,268,156 T28A probably damaging Het
Akap3 A T 6: 126,865,655 K412N probably damaging Het
Atl1 A G 12: 69,931,622 I123V probably benign Het
Atp10a G A 7: 58,658,540 R29H unknown Het
C4b T C 17: 34,734,733 D967G probably benign Het
Ccdc186 T C 19: 56,806,997 N416S probably damaging Het
Ccna2 T C 3: 36,571,090 probably benign Het
Cep70 T C 9: 99,291,529 L371P probably damaging Het
Cfap46 A T 7: 139,650,837 C958* probably null Het
Crlf2 T C 5: 109,554,973 D318G probably benign Het
Csf1 T C 3: 107,750,756 N14D probably benign Het
Dars A G 1: 128,372,204 Y348H possibly damaging Het
Dnah2 T C 11: 69,498,627 E813G probably damaging Het
Ebi3 T A 17: 55,954,410 M102K probably benign Het
Epg5 A G 18: 78,023,278 D2131G probably benign Het
Fam186a A T 15: 99,942,894 L1823H probably damaging Het
H2-M3 T C 17: 37,272,678 M309T probably benign Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ino80 A G 2: 119,442,586 S470P possibly damaging Het
Kcnh5 C T 12: 75,137,643 probably null Het
Kif24 T C 4: 41,404,687 T438A possibly damaging Het
Kndc1 G A 7: 139,909,043 G205R probably damaging Het
Lrp1b A T 2: 40,822,645 Y3226N Het
Lrp1b G T 2: 40,822,646 D3225E Het
Megf10 G C 18: 57,262,131 G522R probably damaging Het
Mgea5 A T 19: 45,778,607 M110K possibly damaging Het
Nectin2 A T 7: 19,749,268 L12* probably null Het
Ngef A T 1: 87,480,605 M580K probably damaging Het
Olfr1118 A G 2: 87,309,343 M205V probably benign Het
Olfr1437 T C 19: 12,322,108 N240D probably damaging Het
Olfr376 A G 11: 73,375,018 S93G probably benign Het
Pcdhb13 T C 18: 37,444,675 L702P probably damaging Het
Pcdhb17 A G 18: 37,486,092 I312V probably benign Het
Pglyrp3 A G 3: 92,030,678 N265D probably benign Het
Pkd1l2 A G 8: 117,030,682 V1539A probably damaging Het
Rcn2 T C 9: 56,058,069 L274P probably damaging Het
Rpp30 A G 19: 36,104,438 E267G possibly damaging Het
Rundc3a A G 11: 102,398,404 M134V probably damaging Het
Samd3 A T 10: 26,270,106 Q343L possibly damaging Het
Serpinb3c A T 1: 107,271,714 F359Y probably damaging Het
Slc9a9 T C 9: 95,228,941 L604P probably benign Het
Strn3 A T 12: 51,610,163 H777Q probably damaging Het
Tap1 G A 17: 34,190,642 W284* probably null Het
Tmem136 C T 9: 43,111,785 W91* probably null Het
Tmem181a A G 17: 6,303,265 D384G possibly damaging Het
Txndc12 T C 4: 108,856,171 S77P probably damaging Het
Wnt16 G A 6: 22,288,561 V19M probably benign Het
Zfp932 T A 5: 110,010,014 M526K probably benign Het
Zfp959 G T 17: 55,898,334 C457F probably damaging Het
Zscan4-ps3 T C 7: 11,612,936 S300P probably benign Het
Other mutations in Fam213b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Fam213b APN 4 154896602 unclassified probably benign
IGL03102:Fam213b APN 4 154896601 unclassified probably benign
R1350:Fam213b UTSW 4 154898128 missense probably damaging 1.00
R1676:Fam213b UTSW 4 154897063 missense probably benign 0.05
R1778:Fam213b UTSW 4 154897357 missense probably damaging 0.98
R2164:Fam213b UTSW 4 154898149 missense probably damaging 1.00
R4468:Fam213b UTSW 4 154897050 missense probably benign 0.01
R5007:Fam213b UTSW 4 154897074 unclassified probably null
R5386:Fam213b UTSW 4 154899005 start codon destroyed probably benign 0.01
R6820:Fam213b UTSW 4 154898166 missense probably damaging 1.00
X0063:Fam213b UTSW 4 154898953 missense probably benign 0.03
Z1176:Fam213b UTSW 4 154898989 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTAGGGAACAACAGTGCTG -3'
(R):5'- TCAGGCCTTAGTATGGCCATG -3'

Sequencing Primer
(F):5'- TGTGGAAGCAGTGAGACGCTC -3'
(R):5'- AGTATGGCCATGATGTCCTGCC -3'
Posted On2019-10-07