Incidental Mutation 'R7437:Zfp932'
ID576666
Institutional Source Beutler Lab
Gene Symbol Zfp932
Ensembl Gene ENSMUSG00000066613
Gene Namezinc finger protein 932
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7437 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location109996521-110010411 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110010014 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 526 (M526K)
Ref Sequence ENSEMBL: ENSMUSP00000108159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099484] [ENSMUST00000112536] [ENSMUST00000112540] [ENSMUST00000125213] [ENSMUST00000143639] [ENSMUST00000187241]
Predicted Effect probably benign
Transcript: ENSMUST00000099484
SMART Domains Protein: ENSMUSP00000097083
Gene: ENSMUSG00000066613

DomainStartEndE-ValueType
KRAB 5 61 1.74e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112536
AA Change: M493K

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000108155
Gene: ENSMUSG00000066613
AA Change: M493K

DomainStartEndE-ValueType
Blast:KRAB 1 31 5e-12 BLAST
ZnF_C2H2 71 93 1.1e-2 SMART
ZnF_C2H2 99 121 5.21e-4 SMART
ZnF_C2H2 127 149 3.39e-3 SMART
ZnF_C2H2 155 177 1.76e-1 SMART
ZnF_C2H2 183 205 1.3e-4 SMART
ZnF_C2H2 211 233 1.1e-2 SMART
ZnF_C2H2 239 261 2.27e-4 SMART
ZnF_C2H2 267 289 1.84e-4 SMART
ZnF_C2H2 295 317 5.21e-4 SMART
ZnF_C2H2 323 345 9.73e-4 SMART
ZnF_C2H2 351 373 1.58e-3 SMART
ZnF_C2H2 379 401 1.58e-3 SMART
ZnF_C2H2 407 429 5.14e-3 SMART
ZnF_C2H2 435 457 2.61e-4 SMART
ZnF_C2H2 463 485 2.43e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112540
AA Change: M526K

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000108159
Gene: ENSMUSG00000066613
AA Change: M526K

DomainStartEndE-ValueType
KRAB 5 61 1.74e-14 SMART
ZnF_C2H2 104 126 1.1e-2 SMART
ZnF_C2H2 132 154 5.21e-4 SMART
ZnF_C2H2 160 182 3.39e-3 SMART
ZnF_C2H2 188 210 1.76e-1 SMART
ZnF_C2H2 216 238 1.3e-4 SMART
ZnF_C2H2 244 266 1.1e-2 SMART
ZnF_C2H2 272 294 2.27e-4 SMART
ZnF_C2H2 300 322 1.84e-4 SMART
ZnF_C2H2 328 350 5.21e-4 SMART
ZnF_C2H2 356 378 9.73e-4 SMART
ZnF_C2H2 384 406 1.58e-3 SMART
ZnF_C2H2 412 434 1.58e-3 SMART
ZnF_C2H2 440 462 5.14e-3 SMART
ZnF_C2H2 468 490 2.61e-4 SMART
ZnF_C2H2 496 518 2.43e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125213
SMART Domains Protein: ENSMUSP00000119843
Gene: ENSMUSG00000066613

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-14 BLAST
ZnF_C2H2 71 93 1.1e-2 SMART
ZnF_C2H2 99 121 5.21e-4 SMART
ZnF_C2H2 127 149 3.39e-3 SMART
ZnF_C2H2 155 177 1.76e-1 SMART
Pfam:zf-C2H2_6 182 191 7.3e-1 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143639
SMART Domains Protein: ENSMUSP00000121749
Gene: ENSMUSG00000066613

DomainStartEndE-ValueType
KRAB 4 60 1.74e-14 SMART
ZnF_C2H2 103 125 1.1e-2 SMART
ZnF_C2H2 131 153 5.21e-4 SMART
ZnF_C2H2 159 181 3.39e-3 SMART
ZnF_C2H2 187 209 1.76e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000187241
AA Change: M526K

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140446
Gene: ENSMUSG00000066613
AA Change: M526K

DomainStartEndE-ValueType
KRAB 5 61 7.1e-17 SMART
ZnF_C2H2 104 126 4.8e-5 SMART
ZnF_C2H2 132 154 2.2e-6 SMART
ZnF_C2H2 160 182 1.5e-5 SMART
ZnF_C2H2 188 210 7.2e-4 SMART
ZnF_C2H2 216 238 5.4e-7 SMART
ZnF_C2H2 244 266 4.5e-5 SMART
ZnF_C2H2 272 294 9.2e-7 SMART
ZnF_C2H2 300 322 7.5e-7 SMART
ZnF_C2H2 328 350 2.1e-6 SMART
ZnF_C2H2 356 378 4e-6 SMART
ZnF_C2H2 384 406 6.5e-6 SMART
ZnF_C2H2 412 434 6.9e-6 SMART
ZnF_C2H2 440 462 2.1e-5 SMART
ZnF_C2H2 468 490 1.1e-6 SMART
ZnF_C2H2 496 518 1.1e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,400,498 I1192F probably damaging Het
Abca8a A G 11: 110,050,964 S1160P probably benign Het
Adamtsl2 A G 2: 27,089,709 I297V probably damaging Het
Aebp1 T A 11: 5,869,757 F687L possibly damaging Het
Ahsa1 A G 12: 87,268,156 T28A probably damaging Het
Akap3 A T 6: 126,865,655 K412N probably damaging Het
Atl1 A G 12: 69,931,622 I123V probably benign Het
Atp10a G A 7: 58,658,540 R29H unknown Het
C4b T C 17: 34,734,733 D967G probably benign Het
Ccdc186 T C 19: 56,806,997 N416S probably damaging Het
Ccna2 T C 3: 36,571,090 probably benign Het
Cep70 T C 9: 99,291,529 L371P probably damaging Het
Cfap46 A T 7: 139,650,837 C958* probably null Het
Crlf2 T C 5: 109,554,973 D318G probably benign Het
Csf1 T C 3: 107,750,756 N14D probably benign Het
Dars A G 1: 128,372,204 Y348H possibly damaging Het
Dnah2 T C 11: 69,498,627 E813G probably damaging Het
Ebi3 T A 17: 55,954,410 M102K probably benign Het
Epg5 A G 18: 78,023,278 D2131G probably benign Het
Fam186a A T 15: 99,942,894 L1823H probably damaging Het
Fam213b C A 4: 154,896,596 C194F possibly damaging Het
H2-M3 T C 17: 37,272,678 M309T probably benign Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ino80 A G 2: 119,442,586 S470P possibly damaging Het
Kcnh5 C T 12: 75,137,643 probably null Het
Kif24 T C 4: 41,404,687 T438A possibly damaging Het
Kndc1 G A 7: 139,909,043 G205R probably damaging Het
Lrp1b A T 2: 40,822,645 Y3226N Het
Lrp1b G T 2: 40,822,646 D3225E Het
Megf10 G C 18: 57,262,131 G522R probably damaging Het
Mgea5 A T 19: 45,778,607 M110K possibly damaging Het
Nectin2 A T 7: 19,749,268 L12* probably null Het
Ngef A T 1: 87,480,605 M580K probably damaging Het
Olfr1118 A G 2: 87,309,343 M205V probably benign Het
Olfr1437 T C 19: 12,322,108 N240D probably damaging Het
Olfr376 A G 11: 73,375,018 S93G probably benign Het
Pcdhb13 T C 18: 37,444,675 L702P probably damaging Het
Pcdhb17 A G 18: 37,486,092 I312V probably benign Het
Pglyrp3 A G 3: 92,030,678 N265D probably benign Het
Pkd1l2 A G 8: 117,030,682 V1539A probably damaging Het
Rcn2 T C 9: 56,058,069 L274P probably damaging Het
Rpp30 A G 19: 36,104,438 E267G possibly damaging Het
Rundc3a A G 11: 102,398,404 M134V probably damaging Het
Samd3 A T 10: 26,270,106 Q343L possibly damaging Het
Serpinb3c A T 1: 107,271,714 F359Y probably damaging Het
Slc9a9 T C 9: 95,228,941 L604P probably benign Het
Strn3 A T 12: 51,610,163 H777Q probably damaging Het
Tap1 G A 17: 34,190,642 W284* probably null Het
Tmem136 C T 9: 43,111,785 W91* probably null Het
Tmem181a A G 17: 6,303,265 D384G possibly damaging Het
Txndc12 T C 4: 108,856,171 S77P probably damaging Het
Wnt16 G A 6: 22,288,561 V19M probably benign Het
Zfp959 G T 17: 55,898,334 C457F probably damaging Het
Zscan4-ps3 T C 7: 11,612,936 S300P probably benign Het
Other mutations in Zfp932
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0153:Zfp932 UTSW 5 110006968 missense probably benign 0.27
R0268:Zfp932 UTSW 5 110009063 missense probably benign 0.24
R1673:Zfp932 UTSW 5 110008988 missense probably damaging 1.00
R1797:Zfp932 UTSW 5 109996623 start gained probably benign
R1893:Zfp932 UTSW 5 110009203 missense possibly damaging 0.71
R1942:Zfp932 UTSW 5 110006987 missense probably damaging 1.00
R2073:Zfp932 UTSW 5 110009818 missense possibly damaging 0.60
R2076:Zfp932 UTSW 5 110009468 missense probably benign 0.01
R2329:Zfp932 UTSW 5 110009540 missense probably benign 0.01
R3944:Zfp932 UTSW 5 110009954 missense probably benign 0.37
R4551:Zfp932 UTSW 5 110009639 missense probably benign 0.03
R4679:Zfp932 UTSW 5 110009894 missense probably damaging 1.00
R4692:Zfp932 UTSW 5 110009186 missense probably damaging 1.00
R5116:Zfp932 UTSW 5 110009376 missense probably benign 0.05
R5260:Zfp932 UTSW 5 110009635 nonsense probably null
R5536:Zfp932 UTSW 5 110009847 nonsense probably null
R6351:Zfp932 UTSW 5 110009343 nonsense probably null
R6786:Zfp932 UTSW 5 110009740 missense probably damaging 0.98
R6843:Zfp932 UTSW 5 110008715 missense probably benign 0.02
R7496:Zfp932 UTSW 5 110008828 missense probably damaging 0.97
R7704:Zfp932 UTSW 5 110009764 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AAGCCTTTGCACGACACAGT -3'
(R):5'- TCTTGATCAGAAGCCAGAAGACTCT -3'

Sequencing Primer
(F):5'- CAATGTGGTAAAGCCCTTGC -3'
(R):5'- TGTGGATCTCAAGGTCCAAGC -3'
Posted On2019-10-07