Mutagenetix > Incidental Mutations

Incidental Mutation 'R7437:Atp10a'

576672

Institutional Source

Beutler Lab

Gene Symbol

Atp10a

Ensembl Gene

ENSMUSG00000025324

Gene Name

ATPase, class V, type 10A

Synonyms

Atp10c, pfatp

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.276) question?

Stock #

R7437 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58656166-58829420 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 58658540 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 29 (R29H)

Ref Sequence

ENSEMBL: ENSMUSP00000129811 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168747] [ENSMUST00000207668]

Predicted Effect

unknown
Transcript: ENSMUST00000168747
AA Change: R29H

SMART Domains

Protein: ENSMUSP00000129811
Gene: ENSMUSG00000025324
AA Change: R29H

Domain	Start	End	E-Value	Type
low complexity region	15	32	N/A	INTRINSIC
Pfam:PhoLip_ATPase_N	55	114	5.2e-23	PFAM
Pfam:E1-E2_ATPase	120	393	6.6e-10	PFAM
low complexity region	633	643	N/A	INTRINSIC
Pfam:Cation_ATPase	685	791	1.5e-7	PFAM
Pfam:HAD	697	1054	2.1e-12	PFAM
Pfam:PhoLip_ATPase_C	1071	1316	1.1e-76	PFAM
low complexity region	1458	1477	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000207668
AA Change: R29H

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. This gene is maternally expressed. It maps within the most common interval of deletion responsible for Angelman syndrome, also known as 'happy puppet syndrome'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene at the distal end of the p^23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	A	T	17: 24,400,498	I1192F	probably damaging	Het
Abca8a	A	G	11: 110,050,964	S1160P	probably benign	Het
Adamtsl2	A	G	2: 27,089,709	I297V	probably damaging	Het
Aebp1	T	A	11: 5,869,757	F687L	possibly damaging	Het
Ahsa1	A	G	12: 87,268,156	T28A	probably damaging	Het
Akap3	A	T	6: 126,865,655	K412N	probably damaging	Het
Atl1	A	G	12: 69,931,622	I123V	probably benign	Het
C4b	T	C	17: 34,734,733	D967G	probably benign	Het
Ccdc186	T	C	19: 56,806,997	N416S	probably damaging	Het
Ccna2	T	C	3: 36,571,090		probably benign	Het
Cep70	T	C	9: 99,291,529	L371P	probably damaging	Het
Cfap46	A	T	7: 139,650,837	C958*	probably null	Het
Crlf2	T	C	5: 109,554,973	D318G	probably benign	Het
Csf1	T	C	3: 107,750,756	N14D	probably benign	Het
Dars	A	G	1: 128,372,204	Y348H	possibly damaging	Het
Dnah2	T	C	11: 69,498,627	E813G	probably damaging	Het
Ebi3	T	A	17: 55,954,410	M102K	probably benign	Het
Epg5	A	G	18: 78,023,278	D2131G	probably benign	Het
Fam186a	A	T	15: 99,942,894	L1823H	probably damaging	Het
Fam213b	C	A	4: 154,896,596	C194F	possibly damaging	Het
H2-M3	T	C	17: 37,272,678	M309T	probably benign	Het
Ift122	C	T	6: 115,926,302	R1176C	probably benign	Het
Ino80	A	G	2: 119,442,586	S470P	possibly damaging	Het
Kcnh5	C	T	12: 75,137,643		probably null	Het
Kif24	T	C	4: 41,404,687	T438A	possibly damaging	Het
Kndc1	G	A	7: 139,909,043	G205R	probably damaging	Het
Lrp1b	A	T	2: 40,822,645	Y3226N		Het
Lrp1b	G	T	2: 40,822,646	D3225E		Het
Megf10	G	C	18: 57,262,131	G522R	probably damaging	Het
Mgea5	A	T	19: 45,778,607	M110K	possibly damaging	Het
Nectin2	A	T	7: 19,749,268	L12*	probably null	Het
Ngef	A	T	1: 87,480,605	M580K	probably damaging	Het
Olfr1118	A	G	2: 87,309,343	M205V	probably benign	Het
Olfr1437	T	C	19: 12,322,108	N240D	probably damaging	Het
Olfr376	A	G	11: 73,375,018	S93G	probably benign	Het
Pcdhb13	T	C	18: 37,444,675	L702P	probably damaging	Het
Pcdhb17	A	G	18: 37,486,092	I312V	probably benign	Het
Pglyrp3	A	G	3: 92,030,678	N265D	probably benign	Het
Pkd1l2	A	G	8: 117,030,682	V1539A	probably damaging	Het
Rcn2	T	C	9: 56,058,069	L274P	probably damaging	Het
Rpp30	A	G	19: 36,104,438	E267G	possibly damaging	Het
Rundc3a	A	G	11: 102,398,404	M134V	probably damaging	Het
Samd3	A	T	10: 26,270,106	Q343L	possibly damaging	Het
Serpinb3c	A	T	1: 107,271,714	F359Y	probably damaging	Het
Slc9a9	T	C	9: 95,228,941	L604P	probably benign	Het
Strn3	A	T	12: 51,610,163	H777Q	probably damaging	Het
Tap1	G	A	17: 34,190,642	W284*	probably null	Het
Tmem136	C	T	9: 43,111,785	W91*	probably null	Het
Tmem181a	A	G	17: 6,303,265	D384G	possibly damaging	Het
Txndc12	T	C	4: 108,856,171	S77P	probably damaging	Het
Wnt16	G	A	6: 22,288,561	V19M	probably benign	Het
Zfp932	T	A	5: 110,010,014	M526K	probably benign	Het
Zfp959	G	T	17: 55,898,334	C457F	probably damaging	Het
Zscan4-ps3	T	C	7: 11,612,936	S300P	probably benign	Het

Other mutations in Atp10a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00649:Atp10a	APN	7	58794482	missense	probably benign	0.06
IGL00973:Atp10a	APN	7	58807470	missense	probably damaging	1.00
IGL00984:Atp10a	APN	7	58658741	missense	probably damaging	1.00
IGL01086:Atp10a	APN	7	58824318	missense	probably damaging	0.96
IGL01296:Atp10a	APN	7	58813625	missense	probably benign	0.02
IGL01731:Atp10a	APN	7	58797562	missense	probably benign	0.16
IGL02081:Atp10a	APN	7	58827856	missense	possibly damaging	0.62
IGL02095:Atp10a	APN	7	58807393	missense	probably damaging	1.00
IGL02549:Atp10a	APN	7	58819733	missense	probably benign	0.00
IGL02558:Atp10a	APN	7	58819642	missense	probably damaging	0.98
IGL02659:Atp10a	APN	7	58813631	missense	probably benign
IGL02986:Atp10a	APN	7	58828721	missense	probably benign
IGL03218:Atp10a	APN	7	58788448	critical splice donor site	probably null
PIT4260001:Atp10a	UTSW	7	58791118	nonsense	probably null
PIT4445001:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
PIT4810001:Atp10a	UTSW	7	58813848	missense	probably damaging	0.99
R0091:Atp10a	UTSW	7	58774046	splice site	probably benign
R0349:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
R0426:Atp10a	UTSW	7	58784734	missense	probably benign	0.00
R0609:Atp10a	UTSW	7	58819740	splice site	probably null
R0722:Atp10a	UTSW	7	58816183	missense	possibly damaging	0.75
R0741:Atp10a	UTSW	7	58828589	missense	possibly damaging	0.90
R1172:Atp10a	UTSW	7	58803766	missense	probably benign	0.05
R1342:Atp10a	UTSW	7	58816146	splice site	probably benign
R1648:Atp10a	UTSW	7	58784827	missense	probably damaging	1.00
R1715:Atp10a	UTSW	7	58786505	missense	probably damaging	0.98
R1737:Atp10a	UTSW	7	58827238	splice site	probably benign
R1799:Atp10a	UTSW	7	58824434	missense	probably damaging	1.00
R1909:Atp10a	UTSW	7	58828712	missense	probably benign	0.12
R1918:Atp10a	UTSW	7	58827935	missense	possibly damaging	0.82
R2031:Atp10a	UTSW	7	58827930	nonsense	probably null
R2080:Atp10a	UTSW	7	58824327	missense	probably damaging	0.97
R2424:Atp10a	UTSW	7	58794555	missense	probably benign	0.16
R2696:Atp10a	UTSW	7	58813618	missense	probably benign	0.00
R3932:Atp10a	UTSW	7	58827104	missense	possibly damaging	0.69
R4198:Atp10a	UTSW	7	58813686	missense	probably damaging	1.00
R4453:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4632:Atp10a	UTSW	7	58807438	missense	possibly damaging	0.48
R4661:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4782:Atp10a	UTSW	7	58791095	missense	probably benign
R4888:Atp10a	UTSW	7	58785307	missense	probably damaging	1.00
R4935:Atp10a	UTSW	7	58813764	missense	probably damaging	1.00
R5051:Atp10a	UTSW	7	58740246	frame shift	probably null
R5213:Atp10a	UTSW	7	58773983	missense	probably damaging	0.99
R5617:Atp10a	UTSW	7	58803675	missense	probably benign	0.06
R5834:Atp10a	UTSW	7	58658618	missense	probably benign	0.01
R5885:Atp10a	UTSW	7	58813800	missense	possibly damaging	0.92
R6013:Atp10a	UTSW	7	58797790	missense	probably benign	0.05
R6136:Atp10a	UTSW	7	58828340	missense	probably benign
R6269:Atp10a	UTSW	7	58803739	missense	possibly damaging	0.51
R6380:Atp10a	UTSW	7	58819684	nonsense	probably null
R6743:Atp10a	UTSW	7	58797814	missense	possibly damaging	0.89
R6875:Atp10a	UTSW	7	58797352	missense	probably benign	0.01
R6975:Atp10a	UTSW	7	58773985	missense	probably damaging	1.00
R7082:Atp10a	UTSW	7	58658819	missense	probably damaging	1.00
R7203:Atp10a	UTSW	7	58786473	missense	probably benign
R7224:Atp10a	UTSW	7	58797471	missense	probably benign	0.00
R7287:Atp10a	UTSW	7	58827269	missense	probably damaging	1.00
R7474:Atp10a	UTSW	7	58658527	missense	unknown
R7530:Atp10a	UTSW	7	58773976	missense	probably benign	0.02
R7561:Atp10a	UTSW	7	58827133	missense	probably damaging	0.98
R7743:Atp10a	UTSW	7	58803709	missense	probably damaging	1.00
R7767:Atp10a	UTSW	7	58658849	missense	probably damaging	1.00
R7861:Atp10a	UTSW	7	58788359	missense	probably damaging	1.00
R7903:Atp10a	UTSW	7	58658822	missense	probably damaging	1.00
R7944:Atp10a	UTSW	7	58788359	missense	probably damaging	1.00
R7986:Atp10a	UTSW	7	58658822	missense	probably damaging	1.00
R8015:Atp10a	UTSW	7	58803497	missense	not run
Z1176:Atp10a	UTSW	7	58788447	critical splice donor site	unknown

Predicted Primers

PCR Primer
(F):5'- AGACCTGGAAGTCTGGACAG -3'
(R):5'- AAGTACACATTGGCTAGGCGG -3'

Sequencing Primer
(F):5'- TGGAAGTCTGGACAGGCTGC -3'
(R):5'- CATTGGCTAGGCGGTGGAAC -3'

Posted On

2019-10-07