Incidental Mutation 'R7437:Akap3'
ID576669
Institutional Source Beutler Lab
Gene Symbol Akap3
Ensembl Gene ENSMUSG00000030344
Gene NameA kinase (PRKA) anchor protein 3
SynonymsAkap110; Sob1; Fsp95
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_009650.2; MGI:1341149

Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7437 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location126853098-126874308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126865655 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 412 (K412N)
Ref Sequence ENSEMBL: ENSMUSP00000093091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095440] [ENSMUST00000202574] [ENSMUST00000202878]
Predicted Effect probably damaging
Transcript: ENSMUST00000095440
AA Change: K412N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093091
Gene: ENSMUSG00000030344
AA Change: K412N

DomainStartEndE-ValueType
AKAP_110 5 864 N/A SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202574
AA Change: K412N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144405
Gene: ENSMUSG00000030344
AA Change: K412N

DomainStartEndE-ValueType
AKAP_110 5 864 N/A SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202878
AA Change: K412N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143794
Gene: ENSMUSG00000030344
AA Change: K412N

DomainStartEndE-ValueType
AKAP_110 5 864 N/A SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of A-kinase anchoring proteins (AKAPs), a family of functionally related proteins that target protein kinase A to discrete locations within the cell. The encoded protein is reported to participate in protein-protein interactions with the R-subunit of the protein kinase A as well as sperm-associated proteins. This protein is expressed in spermatozoa and localized to the acrosomal region of the sperm head as well as the length of the principal piece. It may function as a regulator of motility, capacitation, and the acrosome reaction. [provided by RefSeq, May 2013]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,400,498 I1192F probably damaging Het
Abca8a A G 11: 110,050,964 S1160P probably benign Het
Adamtsl2 A G 2: 27,089,709 I297V probably damaging Het
Aebp1 T A 11: 5,869,757 F687L possibly damaging Het
Ahsa1 A G 12: 87,268,156 T28A probably damaging Het
Atl1 A G 12: 69,931,622 I123V probably benign Het
Atp10a G A 7: 58,658,540 R29H unknown Het
C4b T C 17: 34,734,733 D967G probably benign Het
Ccdc186 T C 19: 56,806,997 N416S probably damaging Het
Ccna2 T C 3: 36,571,090 probably benign Het
Cep70 T C 9: 99,291,529 L371P probably damaging Het
Cfap46 A T 7: 139,650,837 C958* probably null Het
Crlf2 T C 5: 109,554,973 D318G probably benign Het
Csf1 T C 3: 107,750,756 N14D probably benign Het
Dars A G 1: 128,372,204 Y348H possibly damaging Het
Dnah2 T C 11: 69,498,627 E813G probably damaging Het
Ebi3 T A 17: 55,954,410 M102K probably benign Het
Epg5 A G 18: 78,023,278 D2131G probably benign Het
Fam186a A T 15: 99,942,894 L1823H probably damaging Het
Fam213b C A 4: 154,896,596 C194F possibly damaging Het
H2-M3 T C 17: 37,272,678 M309T probably benign Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ino80 A G 2: 119,442,586 S470P possibly damaging Het
Kcnh5 C T 12: 75,137,643 probably null Het
Kif24 T C 4: 41,404,687 T438A possibly damaging Het
Kndc1 G A 7: 139,909,043 G205R probably damaging Het
Lrp1b A T 2: 40,822,645 Y3226N Het
Lrp1b G T 2: 40,822,646 D3225E Het
Megf10 G C 18: 57,262,131 G522R probably damaging Het
Mgea5 A T 19: 45,778,607 M110K possibly damaging Het
Nectin2 A T 7: 19,749,268 L12* probably null Het
Ngef A T 1: 87,480,605 M580K probably damaging Het
Olfr1118 A G 2: 87,309,343 M205V probably benign Het
Olfr1437 T C 19: 12,322,108 N240D probably damaging Het
Olfr376 A G 11: 73,375,018 S93G probably benign Het
Pcdhb13 T C 18: 37,444,675 L702P probably damaging Het
Pcdhb17 A G 18: 37,486,092 I312V probably benign Het
Pglyrp3 A G 3: 92,030,678 N265D probably benign Het
Pkd1l2 A G 8: 117,030,682 V1539A probably damaging Het
Rcn2 T C 9: 56,058,069 L274P probably damaging Het
Rpp30 A G 19: 36,104,438 E267G possibly damaging Het
Rundc3a A G 11: 102,398,404 M134V probably damaging Het
Samd3 A T 10: 26,270,106 Q343L possibly damaging Het
Serpinb3c A T 1: 107,271,714 F359Y probably damaging Het
Slc9a9 T C 9: 95,228,941 L604P probably benign Het
Strn3 A T 12: 51,610,163 H777Q probably damaging Het
Tap1 G A 17: 34,190,642 W284* probably null Het
Tmem136 C T 9: 43,111,785 W91* probably null Het
Tmem181a A G 17: 6,303,265 D384G possibly damaging Het
Txndc12 T C 4: 108,856,171 S77P probably damaging Het
Wnt16 G A 6: 22,288,561 V19M probably benign Het
Zfp932 T A 5: 110,010,014 M526K probably benign Het
Zfp959 G T 17: 55,898,334 C457F probably damaging Het
Zscan4-ps3 T C 7: 11,612,936 S300P probably benign Het
Other mutations in Akap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Akap3 APN 6 126865731 missense probably benign 0.38
IGL01070:Akap3 APN 6 126865879 missense possibly damaging 0.93
IGL01975:Akap3 APN 6 126874000 missense probably damaging 1.00
IGL02114:Akap3 APN 6 126865996 missense probably damaging 0.99
IGL02349:Akap3 APN 6 126860263 missense probably benign 0.01
IGL03305:Akap3 APN 6 126864765 missense probably benign
IGL03412:Akap3 APN 6 126864725 missense probably benign 0.00
IGL03097:Akap3 UTSW 6 126866416 missense probably damaging 1.00
P0012:Akap3 UTSW 6 126864601 missense possibly damaging 0.87
R0358:Akap3 UTSW 6 126866812 missense probably damaging 1.00
R1123:Akap3 UTSW 6 126865966 missense probably benign 0.27
R1163:Akap3 UTSW 6 126864787 missense probably damaging 1.00
R1458:Akap3 UTSW 6 126865554 missense probably damaging 1.00
R1769:Akap3 UTSW 6 126865846 missense possibly damaging 0.67
R1967:Akap3 UTSW 6 126865098 missense probably benign 0.02
R4030:Akap3 UTSW 6 126865021 missense probably damaging 1.00
R4618:Akap3 UTSW 6 126866443 missense probably benign 0.31
R4677:Akap3 UTSW 6 126865263 missense probably damaging 0.99
R4735:Akap3 UTSW 6 126865638 missense probably damaging 1.00
R5660:Akap3 UTSW 6 126865291 missense probably damaging 1.00
R5834:Akap3 UTSW 6 126865833 missense probably benign 0.04
R5847:Akap3 UTSW 6 126865558 missense probably damaging 1.00
R6053:Akap3 UTSW 6 126866533 missense probably damaging 0.98
R7007:Akap3 UTSW 6 126866476 missense probably damaging 0.99
R7070:Akap3 UTSW 6 126874024 missense probably damaging 1.00
R7123:Akap3 UTSW 6 126866304 missense probably benign 0.05
R7173:Akap3 UTSW 6 126864766 missense probably benign
R7238:Akap3 UTSW 6 126865237 missense probably benign 0.00
R7731:Akap3 UTSW 6 126865068 missense probably benign 0.04
R7737:Akap3 UTSW 6 126874102 missense probably damaging 1.00
R8073:Akap3 UTSW 6 126865773 missense probably damaging 1.00
X0028:Akap3 UTSW 6 126865917 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCGACTCCTTCATGAAGAAC -3'
(R):5'- CTCTTGTGCCACATGTGCAG -3'

Sequencing Primer
(F):5'- ATGACTGACACAGACTTTGTCTCGG -3'
(R):5'- TGTGCAGTCCCTCCTTAATAATATG -3'
Posted On2019-10-07