Incidental Mutation 'R7497:D11Wsu47e'
ID581156
Institutional Source Beutler Lab
Gene Symbol D11Wsu47e
Ensembl Gene ENSMUSG00000041623
Gene NameDNA segment, Chr 11, Wayne State University 47, expressed
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7497 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location113684412-113694647 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113692397 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 517 (W517R)
Ref Sequence ENSEMBL: ENSMUSP00000042025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042227] [ENSMUST00000106621] [ENSMUST00000123466] [ENSMUST00000153732]
Predicted Effect probably damaging
Transcript: ENSMUST00000042227
AA Change: W517R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042025
Gene: ENSMUSG00000041623
AA Change: W517R

DomainStartEndE-ValueType
low complexity region 273 283 N/A INTRINSIC
low complexity region 491 510 N/A INTRINSIC
transmembrane domain 529 548 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106621
AA Change: W517R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102232
Gene: ENSMUSG00000041623
AA Change: W517R

DomainStartEndE-ValueType
low complexity region 273 283 N/A INTRINSIC
low complexity region 491 510 N/A INTRINSIC
transmembrane domain 529 548 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123466
Predicted Effect probably benign
Transcript: ENSMUST00000153732
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T A 15: 91,191,176 I145F probably benign Het
Acvr2b T A 9: 119,433,286 V455E probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Agap2 T C 10: 127,090,965 V977A probably damaging Het
Als2cr12 T A 1: 58,678,308 D148V probably damaging Het
Aph1b A C 9: 66,794,119 S79A probably damaging Het
Atm G A 9: 53,511,891 S645L probably benign Het
Ccdc173 A C 2: 69,758,448 N439K probably benign Het
Cdh11 T C 8: 102,673,824 R171G probably benign Het
Ces2f T A 8: 104,954,698 D556E probably benign Het
Cyp26b1 C A 6: 84,576,982 V218L possibly damaging Het
Diaph1 T C 18: 37,895,300 probably null Het
Dock1 A G 7: 134,765,274 I482V probably benign Het
Dok4 A T 8: 94,867,425 D47E possibly damaging Het
Dqx1 T A 6: 83,059,047 L120Q probably damaging Het
Duxf3 A T 10: 58,230,736 V157E probably damaging Het
Eif2a C A 3: 58,548,681 P367Q probably damaging Het
Elp2 C T 18: 24,611,928 R102C probably damaging Het
Erich2 T C 2: 70,534,322 S347P probably damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,735,422 probably null Het
Gadl1 A T 9: 116,074,087 I495L probably benign Het
Gcnt4 A G 13: 96,946,960 T255A possibly damaging Het
Gm10972 A G 3: 94,643,580 K21E unknown Het
Gm11639 T C 11: 104,762,690 probably null Het
Gm7361 C A 5: 26,261,190 H183Q probably benign Het
Gp2 C T 7: 119,454,606 C44Y probably damaging Het
Hcar2 C T 5: 123,865,186 V85I probably benign Het
Hira T C 16: 18,952,079 V822A probably damaging Het
Ighv1-5 T A 12: 114,513,536 T49S probably damaging Het
Ints1 C T 5: 139,768,976 V603M probably damaging Het
Kdm2a A C 19: 4,324,376 L909R probably damaging Het
Klkb1 T A 8: 45,294,790 probably benign Het
Krit1 A G 5: 3,812,349 H168R possibly damaging Het
Map3k21 A T 8: 125,927,601 E386D probably damaging Het
Muc16 C T 9: 18,645,089 E3303K unknown Het
Muc5b T G 7: 141,861,513 V2732G possibly damaging Het
Myo5a T C 9: 75,197,701 L189P Het
Nlrc5 T C 8: 94,521,970 L1740S probably damaging Het
Nolc1 A G 19: 46,082,818 K402R probably benign Het
Olfr1272 T A 2: 90,281,754 T274S possibly damaging Het
Olfr52 T C 2: 86,182,073 I13V probably benign Het
Olfr601 T C 7: 103,359,012 M61V probably damaging Het
Olfr727 T A 14: 50,127,495 L306Q probably benign Het
Pnmal2 A G 7: 16,944,949 probably benign Het
Pnpt1 A T 11: 29,130,860 M35L probably benign Het
Postn A G 3: 54,362,670 K57E probably damaging Het
Ppp1r9a A C 6: 4,905,775 D110A probably damaging Het
Pptc7 G A 5: 122,284,879 V71M possibly damaging Het
Prdm11 T A 2: 93,012,707 I136F possibly damaging Het
Rfc1 A G 5: 65,279,498 L613P probably damaging Het
Ryr3 T C 2: 112,730,473 D2981G probably benign Het
Sbf2 C A 7: 110,614,716 E16* probably null Het
Scara3 T C 14: 65,931,202 E322G probably damaging Het
Sema5b T A 16: 35,661,330 C893S probably damaging Het
Setdb1 T C 3: 95,341,828 D323G probably damaging Het
Slc19a3 T C 1: 83,013,928 Y453C probably damaging Het
Snx5 T C 2: 144,257,974 K137E probably damaging Het
Taar8c G A 10: 24,101,218 T232I probably benign Het
Taok2 G A 7: 126,874,878 T352I probably damaging Het
Ttc3 C A 16: 94,418,682 R489S possibly damaging Het
Usp12 A T 5: 146,752,454 probably null Het
Usp16 T A 16: 87,466,286 C125* probably null Het
Vmn2r106 C T 17: 20,267,939 E733K probably damaging Het
Vps13b T A 15: 35,876,697 I2832K probably benign Het
Vps13c A G 9: 67,840,479 Y18C probably damaging Het
Zfp160 T A 17: 21,026,193 I335K probably benign Het
Zfp788 A T 7: 41,648,851 I304F possibly damaging Het
Other mutations in D11Wsu47e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:D11Wsu47e APN 11 113692470 missense probably benign 0.19
IGL01701:D11Wsu47e APN 11 113689101 missense probably benign 0.27
R0483:D11Wsu47e UTSW 11 113689195 missense possibly damaging 0.92
R0601:D11Wsu47e UTSW 11 113687886 missense probably benign 0.38
R1567:D11Wsu47e UTSW 11 113687902 missense probably damaging 0.99
R4834:D11Wsu47e UTSW 11 113688979 missense probably benign 0.03
R4923:D11Wsu47e UTSW 11 113688979 missense probably benign 0.03
R5194:D11Wsu47e UTSW 11 113688828 missense possibly damaging 0.83
R5779:D11Wsu47e UTSW 11 113687992 missense probably benign 0.02
R5815:D11Wsu47e UTSW 11 113687957 unclassified probably null
R6174:D11Wsu47e UTSW 11 113688975 missense possibly damaging 0.46
R6566:D11Wsu47e UTSW 11 113687998 missense probably damaging 0.96
R6837:D11Wsu47e UTSW 11 113688613 missense possibly damaging 0.90
R6974:D11Wsu47e UTSW 11 113687992 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGCTTAGCCCTGCTGTCTATTG -3'
(R):5'- GCAGAGACCTTTAACGGACTC -3'

Sequencing Primer
(F):5'- GCCCTGCTGTCTATTGAATTAACATG -3'
(R):5'- GAGACCTTTAACGGACTCCACAG -3'
Posted On2019-10-17