Incidental Mutation 'R7497:Sbf2'
ID 581133
Institutional Source Beutler Lab
Gene Symbol Sbf2
Ensembl Gene ENSMUSG00000038371
Gene Name SET binding factor 2
Synonyms B430219L04Rik, 4833411B01Rik, SBF2, Mtmr13, mMTMH1
MMRRC Submission 045570-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.458) question?
Stock # R7497 (G1)
Quality Score 103.008
Status Validated
Chromosome 7
Chromosomal Location 109907220-110214129 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 110213923 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 16 (E16*)
Ref Sequence ENSEMBL: ENSMUSP00000129805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033058] [ENSMUST00000164759] [ENSMUST00000166020] [ENSMUST00000167652] [ENSMUST00000171218]
AlphaFold E9PXF8
Predicted Effect probably null
Transcript: ENSMUST00000033058
AA Change: E16*
SMART Domains Protein: ENSMUSP00000033058
Gene: ENSMUSG00000038371
AA Change: E16*

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 420 2e-20 SMART
Pfam:SBF2 530 752 3.3e-106 PFAM
GRAM 869 955 1.3e-12 SMART
low complexity region 1078 1089 N/A INTRINSIC
Pfam:Myotub-related 1091 1544 8.3e-86 PFAM
PH 1767 1872 3.05e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000164759
AA Change: E16*
SMART Domains Protein: ENSMUSP00000132072
Gene: ENSMUSG00000038371
AA Change: E16*

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 420 2e-20 SMART
Pfam:SBF2 528 752 1.6e-107 PFAM
GRAM 869 955 1.3e-12 SMART
Pfam:Myotub-related 1089 1521 1.6e-98 PFAM
PH 1742 1847 3.05e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166020
AA Change: E16*
SMART Domains Protein: ENSMUSP00000126217
Gene: ENSMUSG00000038371
AA Change: E16*

DomainStartEndE-ValueType
uDENN 1 75 9.26e-1 SMART
DENN 70 252 5.68e-75 SMART
dDENN 305 374 2e-20 SMART
Pfam:SBF2 482 706 1.6e-107 PFAM
GRAM 823 909 1.3e-12 SMART
Pfam:Myotub-related 1043 1500 5.9e-98 PFAM
PH 1721 1826 3.05e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167652
AA Change: E16*
Predicted Effect probably null
Transcript: ENSMUST00000171218
AA Change: E16*
SMART Domains Protein: ENSMUSP00000129805
Gene: ENSMUSG00000038371
AA Change: E16*

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 407 1.5e-1 SMART
Meta Mutation Damage Score 0.9664 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudophosphatase and member of the myotubularin-related protein family. This gene maps within the CMT4B2 candidate region of chromosome 11p15 and mutations in this gene have been associated with Charcot-Marie-Tooth Disease, type 4B2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null alleles display progressive misfolding of myelin sheaths and abnormal nerve electrophysiology. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T A 15: 91,075,379 (GRCm39) I145F probably benign Het
Acvr2b T A 9: 119,262,352 (GRCm39) V455E probably benign Het
Adgrv1 A T 13: 81,588,344 (GRCm39) V4414E possibly damaging Het
Agap2 T C 10: 126,926,834 (GRCm39) V977A probably damaging Het
Aph1b A C 9: 66,701,401 (GRCm39) S79A probably damaging Het
Atm G A 9: 53,423,191 (GRCm39) S645L probably benign Het
Cdh11 T C 8: 103,400,456 (GRCm39) R171G probably benign Het
Ces2f T A 8: 105,681,330 (GRCm39) D556E probably benign Het
Cfap210 A C 2: 69,588,792 (GRCm39) N439K probably benign Het
Cyp26b1 C A 6: 84,553,964 (GRCm39) V218L possibly damaging Het
Diaph1 T C 18: 38,028,353 (GRCm39) probably null Het
Dock1 A G 7: 134,367,003 (GRCm39) I482V probably benign Het
Dok4 A T 8: 95,594,053 (GRCm39) D47E possibly damaging Het
Dqx1 T A 6: 83,036,028 (GRCm39) L120Q probably damaging Het
Duxf3 A T 10: 58,066,558 (GRCm39) V157E probably damaging Het
Efcab3 T C 11: 104,653,516 (GRCm39) probably null Het
Eif2a C A 3: 58,456,102 (GRCm39) P367Q probably damaging Het
Elp2 C T 18: 24,744,985 (GRCm39) R102C probably damaging Het
Erich2 T C 2: 70,364,666 (GRCm39) S347P probably damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,892,766 (GRCm39) probably null Het
Flacc1 T A 1: 58,717,467 (GRCm39) D148V probably damaging Het
Gadl1 A T 9: 115,903,155 (GRCm39) I495L probably benign Het
Gcnt4 A G 13: 97,083,468 (GRCm39) T255A possibly damaging Het
Gm10972 A G 3: 94,550,887 (GRCm39) K21E unknown Het
Gm57859 T A 11: 113,583,223 (GRCm39) W517R probably damaging Het
Gm7361 C A 5: 26,466,188 (GRCm39) H183Q probably benign Het
Gp2 C T 7: 119,053,829 (GRCm39) C44Y probably damaging Het
Hcar2 C T 5: 124,003,249 (GRCm39) V85I probably benign Het
Hira T C 16: 18,770,829 (GRCm39) V822A probably damaging Het
Ighv1-5 T A 12: 114,477,156 (GRCm39) T49S probably damaging Het
Ints1 C T 5: 139,754,731 (GRCm39) V603M probably damaging Het
Kdm2a A C 19: 4,374,404 (GRCm39) L909R probably damaging Het
Klkb1 T A 8: 45,747,827 (GRCm39) probably benign Het
Krit1 A G 5: 3,862,349 (GRCm39) H168R possibly damaging Het
Map3k21 A T 8: 126,654,340 (GRCm39) E386D probably damaging Het
Muc16 C T 9: 18,556,385 (GRCm39) E3303K unknown Het
Muc5b T G 7: 141,415,250 (GRCm39) V2732G possibly damaging Het
Myo5a T C 9: 75,104,983 (GRCm39) L189P Het
Nlrc5 T C 8: 95,248,598 (GRCm39) L1740S probably damaging Het
Nolc1 A G 19: 46,071,257 (GRCm39) K402R probably benign Het
Or4b1b T A 2: 90,112,098 (GRCm39) T274S possibly damaging Het
Or4k15 T A 14: 50,364,952 (GRCm39) L306Q probably benign Het
Or52s19 T C 7: 103,008,219 (GRCm39) M61V probably damaging Het
Or8u8 T C 2: 86,012,417 (GRCm39) I13V probably benign Het
Pnma8b A G 7: 16,678,874 (GRCm39) probably benign Het
Pnpt1 A T 11: 29,080,860 (GRCm39) M35L probably benign Het
Postn A G 3: 54,270,091 (GRCm39) K57E probably damaging Het
Ppp1r9a A C 6: 4,905,775 (GRCm39) D110A probably damaging Het
Pptc7 G A 5: 122,422,942 (GRCm39) V71M possibly damaging Het
Prdm11 T A 2: 92,843,052 (GRCm39) I136F possibly damaging Het
Rfc1 A G 5: 65,436,841 (GRCm39) L613P probably damaging Het
Ryr3 T C 2: 112,560,818 (GRCm39) D2981G probably benign Het
Scara3 T C 14: 66,168,651 (GRCm39) E322G probably damaging Het
Sema5b T A 16: 35,481,700 (GRCm39) C893S probably damaging Het
Setdb1 T C 3: 95,249,139 (GRCm39) D323G probably damaging Het
Slc19a3 T C 1: 82,991,649 (GRCm39) Y453C probably damaging Het
Snx5 T C 2: 144,099,894 (GRCm39) K137E probably damaging Het
Taar8c G A 10: 23,977,116 (GRCm39) T232I probably benign Het
Taok2 G A 7: 126,474,050 (GRCm39) T352I probably damaging Het
Ttc3 C A 16: 94,219,541 (GRCm39) R489S possibly damaging Het
Usp12 A T 5: 146,689,264 (GRCm39) probably null Het
Usp16 T A 16: 87,263,174 (GRCm39) C125* probably null Het
Vmn2r106 C T 17: 20,488,201 (GRCm39) E733K probably damaging Het
Vps13b T A 15: 35,876,843 (GRCm39) I2832K probably benign Het
Vps13c A G 9: 67,747,761 (GRCm39) Y18C probably damaging Het
Zfp160 T A 17: 21,246,455 (GRCm39) I335K probably benign Het
Zfp788 A T 7: 41,298,275 (GRCm39) I304F possibly damaging Het
Other mutations in Sbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sbf2 APN 7 109,975,039 (GRCm39) splice site probably benign
IGL01089:Sbf2 APN 7 109,948,169 (GRCm39) missense probably damaging 1.00
IGL01144:Sbf2 APN 7 109,929,110 (GRCm39) missense probably damaging 1.00
IGL01652:Sbf2 APN 7 110,046,327 (GRCm39) missense probably damaging 1.00
IGL01950:Sbf2 APN 7 109,965,032 (GRCm39) missense probably benign 0.00
IGL02027:Sbf2 APN 7 110,060,348 (GRCm39) missense probably damaging 1.00
IGL02244:Sbf2 APN 7 110,159,502 (GRCm39) missense probably damaging 1.00
IGL02376:Sbf2 APN 7 110,062,163 (GRCm39) missense probably damaging 0.99
IGL03405:Sbf2 APN 7 110,062,139 (GRCm39) missense probably damaging 0.98
N/A - 535:Sbf2 UTSW 7 109,911,959 (GRCm39) missense probably benign
R0084:Sbf2 UTSW 7 110,041,573 (GRCm39) missense possibly damaging 0.95
R0092:Sbf2 UTSW 7 109,920,013 (GRCm39) splice site probably benign
R0121:Sbf2 UTSW 7 110,088,426 (GRCm39) critical splice donor site probably null
R0464:Sbf2 UTSW 7 110,063,783 (GRCm39) splice site probably benign
R0505:Sbf2 UTSW 7 109,998,550 (GRCm39) missense probably damaging 1.00
R0531:Sbf2 UTSW 7 109,966,530 (GRCm39) splice site probably benign
R0554:Sbf2 UTSW 7 110,027,494 (GRCm39) missense probably damaging 1.00
R0617:Sbf2 UTSW 7 109,929,890 (GRCm39) frame shift probably null
R0619:Sbf2 UTSW 7 109,909,469 (GRCm39) missense possibly damaging 0.87
R0799:Sbf2 UTSW 7 109,940,562 (GRCm39) missense possibly damaging 0.58
R0898:Sbf2 UTSW 7 109,970,859 (GRCm39) missense possibly damaging 0.59
R1077:Sbf2 UTSW 7 109,966,379 (GRCm39) splice site probably benign
R1167:Sbf2 UTSW 7 109,963,756 (GRCm39) missense probably damaging 1.00
R1169:Sbf2 UTSW 7 109,909,391 (GRCm39) missense probably benign 0.04
R1424:Sbf2 UTSW 7 109,914,233 (GRCm39) missense probably damaging 1.00
R1536:Sbf2 UTSW 7 109,977,250 (GRCm39) missense probably damaging 1.00
R1558:Sbf2 UTSW 7 110,027,553 (GRCm39) missense probably damaging 1.00
R1601:Sbf2 UTSW 7 109,939,283 (GRCm39) critical splice acceptor site probably null
R1762:Sbf2 UTSW 7 109,911,965 (GRCm39) missense probably benign
R1771:Sbf2 UTSW 7 110,060,353 (GRCm39) nonsense probably null
R1989:Sbf2 UTSW 7 109,948,130 (GRCm39) missense possibly damaging 0.94
R2109:Sbf2 UTSW 7 110,060,419 (GRCm39) missense probably damaging 1.00
R2126:Sbf2 UTSW 7 110,159,502 (GRCm39) missense probably damaging 1.00
R2444:Sbf2 UTSW 7 109,929,905 (GRCm39) missense probably benign 0.31
R3765:Sbf2 UTSW 7 109,974,788 (GRCm39) missense probably damaging 1.00
R3808:Sbf2 UTSW 7 110,088,487 (GRCm39) makesense probably null
R3895:Sbf2 UTSW 7 110,046,298 (GRCm39) missense probably damaging 0.99
R3978:Sbf2 UTSW 7 109,929,092 (GRCm39) missense probably benign 0.00
R4056:Sbf2 UTSW 7 110,040,673 (GRCm39) missense probably damaging 0.99
R4057:Sbf2 UTSW 7 110,040,673 (GRCm39) missense probably damaging 0.99
R4111:Sbf2 UTSW 7 110,027,449 (GRCm39) missense probably damaging 1.00
R4569:Sbf2 UTSW 7 109,948,060 (GRCm39) critical splice donor site probably null
R4670:Sbf2 UTSW 7 109,934,606 (GRCm39) missense probably damaging 1.00
R4763:Sbf2 UTSW 7 110,020,124 (GRCm39) missense probably damaging 1.00
R4792:Sbf2 UTSW 7 109,950,817 (GRCm39) missense probably damaging 0.98
R4811:Sbf2 UTSW 7 109,971,742 (GRCm39) missense probably damaging 1.00
R4822:Sbf2 UTSW 7 109,977,146 (GRCm39) intron probably benign
R5110:Sbf2 UTSW 7 109,963,864 (GRCm39) missense probably benign 0.10
R5143:Sbf2 UTSW 7 110,021,747 (GRCm39) nonsense probably null
R5443:Sbf2 UTSW 7 109,977,135 (GRCm39) intron probably benign
R5457:Sbf2 UTSW 7 109,912,037 (GRCm39) missense probably benign
R5641:Sbf2 UTSW 7 110,038,108 (GRCm39) missense probably damaging 1.00
R5915:Sbf2 UTSW 7 109,977,303 (GRCm39) nonsense probably null
R5948:Sbf2 UTSW 7 110,088,492 (GRCm39) missense probably damaging 1.00
R5977:Sbf2 UTSW 7 109,977,193 (GRCm39) missense probably benign 0.00
R6052:Sbf2 UTSW 7 110,040,741 (GRCm39) missense probably damaging 1.00
R6142:Sbf2 UTSW 7 109,948,182 (GRCm39) missense probably damaging 1.00
R6327:Sbf2 UTSW 7 110,040,759 (GRCm39) missense probably damaging 1.00
R6356:Sbf2 UTSW 7 109,971,830 (GRCm39) missense probably damaging 1.00
R6450:Sbf2 UTSW 7 110,062,070 (GRCm39) missense probably damaging 1.00
R6587:Sbf2 UTSW 7 110,040,182 (GRCm39) missense probably damaging 1.00
R6696:Sbf2 UTSW 7 110,159,505 (GRCm39) missense probably benign 0.04
R6986:Sbf2 UTSW 7 109,929,822 (GRCm39) missense probably damaging 0.99
R7147:Sbf2 UTSW 7 110,046,268 (GRCm39) missense probably benign 0.01
R7358:Sbf2 UTSW 7 109,998,555 (GRCm39) missense possibly damaging 0.95
R7414:Sbf2 UTSW 7 109,913,271 (GRCm39) missense possibly damaging 0.89
R7418:Sbf2 UTSW 7 109,965,028 (GRCm39) missense probably damaging 1.00
R7423:Sbf2 UTSW 7 110,038,055 (GRCm39) missense possibly damaging 0.48
R7425:Sbf2 UTSW 7 109,974,984 (GRCm39) nonsense probably null
R7431:Sbf2 UTSW 7 109,950,957 (GRCm39) missense probably damaging 1.00
R7556:Sbf2 UTSW 7 109,913,260 (GRCm39) missense probably benign 0.20
R7604:Sbf2 UTSW 7 109,977,274 (GRCm39) missense possibly damaging 0.95
R7707:Sbf2 UTSW 7 109,929,920 (GRCm39) critical splice acceptor site probably null
R7746:Sbf2 UTSW 7 110,040,633 (GRCm39) missense probably benign 0.01
R7812:Sbf2 UTSW 7 110,049,170 (GRCm39) missense possibly damaging 0.84
R7849:Sbf2 UTSW 7 109,971,717 (GRCm39) missense probably damaging 1.00
R8026:Sbf2 UTSW 7 109,934,594 (GRCm39) missense probably damaging 1.00
R8048:Sbf2 UTSW 7 109,914,289 (GRCm39) missense probably benign 0.21
R8305:Sbf2 UTSW 7 109,970,825 (GRCm39) missense possibly damaging 0.79
R8337:Sbf2 UTSW 7 110,040,669 (GRCm39) missense probably benign
R8773:Sbf2 UTSW 7 109,948,202 (GRCm39) missense probably benign
R8786:Sbf2 UTSW 7 110,063,793 (GRCm39) critical splice donor site probably null
R8812:Sbf2 UTSW 7 109,929,069 (GRCm39) missense probably damaging 1.00
R8876:Sbf2 UTSW 7 110,049,146 (GRCm39) missense probably damaging 0.99
R8932:Sbf2 UTSW 7 110,040,155 (GRCm39) critical splice donor site probably null
R8954:Sbf2 UTSW 7 110,038,118 (GRCm39) nonsense probably null
R8991:Sbf2 UTSW 7 109,911,896 (GRCm39) missense probably benign 0.20
R9119:Sbf2 UTSW 7 109,911,292 (GRCm39) missense possibly damaging 0.93
R9310:Sbf2 UTSW 7 109,914,292 (GRCm39) missense possibly damaging 0.58
R9344:Sbf2 UTSW 7 109,940,535 (GRCm39) missense probably benign 0.10
R9346:Sbf2 UTSW 7 109,919,946 (GRCm39) missense probably benign 0.05
R9404:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9406:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9408:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9472:Sbf2 UTSW 7 109,970,798 (GRCm39) missense possibly damaging 0.88
R9554:Sbf2 UTSW 7 110,040,671 (GRCm39) missense probably damaging 1.00
R9562:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9624:Sbf2 UTSW 7 109,963,857 (GRCm39) missense probably damaging 1.00
R9652:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9653:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9709:Sbf2 UTSW 7 110,027,514 (GRCm39) missense probably damaging 0.99
RF005:Sbf2 UTSW 7 109,916,215 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCCCTAGGAGCCTCGTAC -3'
(R):5'- TTGTCAAACATGGCTGAAGCG -3'

Sequencing Primer
(F):5'- CTAGGAGCCTCGTACAGTGTG -3'
(R):5'- TGAAGCGCCGCTGCTAC -3'
Posted On 2019-10-17