Mutagenetix > Incidental Mutation

Incidental Mutation 'R7497:Sbf2'

581133

Institutional Source

Beutler Lab

Gene Symbol

Sbf2

Ensembl Gene

ENSMUSG00000038371

Gene Name

SET binding factor 2

Synonyms

mMTMH1, 4833411B01Rik, Mtmr13, B430219L04Rik, SBF2

MMRRC Submission

Accession Numbers

Genbank: NM_177324; MGI: 1921831

Essential gene?

Possibly non essential (E-score: 0.295) question?

Stock #

R7497 (G1)

Quality Score

103.008

Status

Validated

Chromosome

Chromosomal Location

110308013-110614922 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 110614716 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 16 (E16*)

Ref Sequence

ENSEMBL: ENSMUSP00000129805 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033058] [ENSMUST00000164759] [ENSMUST00000166020] [ENSMUST00000167652] [ENSMUST00000171218]

AlphaFold

E9PXF8

Predicted Effect

probably null
Transcript: ENSMUST00000033058
AA Change: E16*

SMART Domains

Protein: ENSMUSP00000033058
Gene: ENSMUSG00000038371
AA Change: E16*

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	420	2e-20	SMART
Pfam:SBF2	530	752	3.3e-106	PFAM
GRAM	869	955	1.3e-12	SMART
low complexity region	1078	1089	N/A	INTRINSIC
Pfam:Myotub-related	1091	1544	8.3e-86	PFAM
PH	1767	1872	3.05e-18	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000164759
AA Change: E16*

SMART Domains

Protein: ENSMUSP00000132072
Gene: ENSMUSG00000038371
AA Change: E16*

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	420	2e-20	SMART
Pfam:SBF2	528	752	1.6e-107	PFAM
GRAM	869	955	1.3e-12	SMART
Pfam:Myotub-related	1089	1521	1.6e-98	PFAM
PH	1742	1847	3.05e-18	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000166020
AA Change: E16*

SMART Domains

Protein: ENSMUSP00000126217
Gene: ENSMUSG00000038371
AA Change: E16*

Domain	Start	End	E-Value	Type
uDENN	1	75	9.26e-1	SMART
DENN	70	252	5.68e-75	SMART
dDENN	305	374	2e-20	SMART
Pfam:SBF2	482	706	1.6e-107	PFAM
GRAM	823	909	1.3e-12	SMART
Pfam:Myotub-related	1043	1500	5.9e-98	PFAM
PH	1721	1826	3.05e-18	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000167652
AA Change: E16*

Predicted Effect

probably null
Transcript: ENSMUST00000171218
AA Change: E16*

SMART Domains

Protein: ENSMUSP00000129805
Gene: ENSMUSG00000038371
AA Change: E16*

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	407	1.5e-1	SMART

Meta Mutation Damage Score

0.9664

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudophosphatase and member of the myotubularin-related protein family. This gene maps within the CMT4B2 candidate region of chromosome 11p15 and mutations in this gene have been associated with Charcot-Marie-Tooth Disease, type 4B2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null alleles display progressive misfolding of myelin sheaths and abnormal nerve electrophysiology. [provided by MGI curators]

Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcd2	T	A	15: 91,191,176	I145F	probably benign	Het
Acvr2b	T	A	9: 119,433,286	V455E	probably benign	Het
Adgrv1	A	T	13: 81,440,225	V4414E	possibly damaging	Het
Agap2	T	C	10: 127,090,965	V977A	probably damaging	Het
Als2cr12	T	A	1: 58,678,308	D148V	probably damaging	Het
Aph1b	A	C	9: 66,794,119	S79A	probably damaging	Het
Atm	G	A	9: 53,511,891	S645L	probably benign	Het
Ccdc173	A	C	2: 69,758,448	N439K	probably benign	Het
Cdh11	T	C	8: 102,673,824	R171G	probably benign	Het
Ces2f	T	A	8: 104,954,698	D556E	probably benign	Het
Cyp26b1	C	A	6: 84,576,982	V218L	possibly damaging	Het
D11Wsu47e	T	A	11: 113,692,397	W517R	probably damaging	Het
Diaph1	T	C	18: 37,895,300		probably null	Het
Dock1	A	G	7: 134,765,274	I482V	probably benign	Het
Dok4	A	T	8: 94,867,425	D47E	possibly damaging	Het
Dqx1	T	A	6: 83,059,047	L120Q	probably damaging	Het
Duxf3	A	T	10: 58,230,736	V157E	probably damaging	Het
Eif2a	C	A	3: 58,548,681	P367Q	probably damaging	Het
Elp2	C	T	18: 24,611,928	R102C	probably damaging	Het
Erich2	T	C	2: 70,534,322	S347P	probably damaging	Het
Fgfr3	GGACCTCTCCGTG	GG	5: 33,735,422		probably null	Het
Gadl1	A	T	9: 116,074,087	I495L	probably benign	Het
Gcnt4	A	G	13: 96,946,960	T255A	possibly damaging	Het
Gm10972	A	G	3: 94,643,580	K21E	unknown	Het
Gm11639	T	C	11: 104,762,690		probably null	Het
Gm7361	C	A	5: 26,261,190	H183Q	probably benign	Het
Gp2	C	T	7: 119,454,606	C44Y	probably damaging	Het
Hcar2	C	T	5: 123,865,186	V85I	probably benign	Het
Hira	T	C	16: 18,952,079	V822A	probably damaging	Het
Ighv1-5	T	A	12: 114,513,536	T49S	probably damaging	Het
Ints1	C	T	5: 139,768,976	V603M	probably damaging	Het
Kdm2a	A	C	19: 4,324,376	L909R	probably damaging	Het
Klkb1	T	A	8: 45,294,790		probably benign	Het
Krit1	A	G	5: 3,812,349	H168R	possibly damaging	Het
Map3k21	A	T	8: 125,927,601	E386D	probably damaging	Het
Muc16	C	T	9: 18,645,089	E3303K	unknown	Het
Muc5b	T	G	7: 141,861,513	V2732G	possibly damaging	Het
Myo5a	T	C	9: 75,197,701	L189P		Het
Nlrc5	T	C	8: 94,521,970	L1740S	probably damaging	Het
Nolc1	A	G	19: 46,082,818	K402R	probably benign	Het
Olfr1272	T	A	2: 90,281,754	T274S	possibly damaging	Het
Olfr52	T	C	2: 86,182,073	I13V	probably benign	Het
Olfr601	T	C	7: 103,359,012	M61V	probably damaging	Het
Olfr727	T	A	14: 50,127,495	L306Q	probably benign	Het
Pnmal2	A	G	7: 16,944,949		probably benign	Het
Pnpt1	A	T	11: 29,130,860	M35L	probably benign	Het
Postn	A	G	3: 54,362,670	K57E	probably damaging	Het
Ppp1r9a	A	C	6: 4,905,775	D110A	probably damaging	Het
Pptc7	G	A	5: 122,284,879	V71M	possibly damaging	Het
Prdm11	T	A	2: 93,012,707	I136F	possibly damaging	Het
Rfc1	A	G	5: 65,279,498	L613P	probably damaging	Het
Ryr3	T	C	2: 112,730,473	D2981G	probably benign	Het
Scara3	T	C	14: 65,931,202	E322G	probably damaging	Het
Sema5b	T	A	16: 35,661,330	C893S	probably damaging	Het
Setdb1	T	C	3: 95,341,828	D323G	probably damaging	Het
Slc19a3	T	C	1: 83,013,928	Y453C	probably damaging	Het
Snx5	T	C	2: 144,257,974	K137E	probably damaging	Het
Taar8c	G	A	10: 24,101,218	T232I	probably benign	Het
Taok2	G	A	7: 126,874,878	T352I	probably damaging	Het
Ttc3	C	A	16: 94,418,682	R489S	possibly damaging	Het
Usp12	A	T	5: 146,752,454		probably null	Het
Usp16	T	A	16: 87,466,286	C125*	probably null	Het
Vmn2r106	C	T	17: 20,267,939	E733K	probably damaging	Het
Vps13b	T	A	15: 35,876,697	I2832K	probably benign	Het
Vps13c	A	G	9: 67,840,479	Y18C	probably damaging	Het
Zfp160	T	A	17: 21,026,193	I335K	probably benign	Het
Zfp788	A	T	7: 41,648,851	I304F	possibly damaging	Het

Other mutations in Sbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Sbf2	APN	7	110375832	splice site	probably benign
IGL01089:Sbf2	APN	7	110348962	missense	probably damaging	1.00
IGL01144:Sbf2	APN	7	110329903	missense	probably damaging	1.00
IGL01652:Sbf2	APN	7	110447120	missense	probably damaging	1.00
IGL01950:Sbf2	APN	7	110365825	missense	probably benign	0.00
IGL02027:Sbf2	APN	7	110461141	missense	probably damaging	1.00
IGL02244:Sbf2	APN	7	110560295	missense	probably damaging	1.00
IGL02376:Sbf2	APN	7	110462956	missense	probably damaging	0.99
IGL03405:Sbf2	APN	7	110462932	missense	probably damaging	0.98
N/A - 535:Sbf2	UTSW	7	110312752	missense	probably benign
R0084:Sbf2	UTSW	7	110442366	missense	possibly damaging	0.95
R0092:Sbf2	UTSW	7	110320806	splice site	probably benign
R0121:Sbf2	UTSW	7	110489219	critical splice donor site	probably null
R0464:Sbf2	UTSW	7	110464576	splice site	probably benign
R0505:Sbf2	UTSW	7	110399343	missense	probably damaging	1.00
R0531:Sbf2	UTSW	7	110367323	splice site	probably benign
R0554:Sbf2	UTSW	7	110428287	missense	probably damaging	1.00
R0617:Sbf2	UTSW	7	110330683	frame shift	probably null
R0619:Sbf2	UTSW	7	110310262	missense	possibly damaging	0.87
R0799:Sbf2	UTSW	7	110341355	missense	possibly damaging	0.58
R0898:Sbf2	UTSW	7	110371652	missense	possibly damaging	0.59
R1077:Sbf2	UTSW	7	110367172	splice site	probably benign
R1167:Sbf2	UTSW	7	110364549	missense	probably damaging	1.00
R1169:Sbf2	UTSW	7	110310184	missense	probably benign	0.04
R1424:Sbf2	UTSW	7	110315026	missense	probably damaging	1.00
R1536:Sbf2	UTSW	7	110378043	missense	probably damaging	1.00
R1558:Sbf2	UTSW	7	110428346	missense	probably damaging	1.00
R1601:Sbf2	UTSW	7	110340076	critical splice acceptor site	probably null
R1762:Sbf2	UTSW	7	110312758	missense	probably benign
R1771:Sbf2	UTSW	7	110461146	nonsense	probably null
R1989:Sbf2	UTSW	7	110348923	missense	possibly damaging	0.94
R2109:Sbf2	UTSW	7	110461212	missense	probably damaging	1.00
R2126:Sbf2	UTSW	7	110560295	missense	probably damaging	1.00
R2444:Sbf2	UTSW	7	110330698	missense	probably benign	0.31
R3765:Sbf2	UTSW	7	110375581	missense	probably damaging	1.00
R3808:Sbf2	UTSW	7	110489280	makesense	probably null
R3895:Sbf2	UTSW	7	110447091	missense	probably damaging	0.99
R3978:Sbf2	UTSW	7	110329885	missense	probably benign	0.00
R4056:Sbf2	UTSW	7	110441466	missense	probably damaging	0.99
R4057:Sbf2	UTSW	7	110441466	missense	probably damaging	0.99
R4111:Sbf2	UTSW	7	110428242	missense	probably damaging	1.00
R4569:Sbf2	UTSW	7	110348853	critical splice donor site	probably null
R4670:Sbf2	UTSW	7	110335399	missense	probably damaging	1.00
R4763:Sbf2	UTSW	7	110420917	missense	probably damaging	1.00
R4792:Sbf2	UTSW	7	110351610	missense	probably damaging	0.98
R4811:Sbf2	UTSW	7	110372535	missense	probably damaging	1.00
R4822:Sbf2	UTSW	7	110377939	intron	probably benign
R5110:Sbf2	UTSW	7	110364657	missense	probably benign	0.10
R5143:Sbf2	UTSW	7	110422540	nonsense	probably null
R5443:Sbf2	UTSW	7	110377928	intron	probably benign
R5457:Sbf2	UTSW	7	110312830	missense	probably benign
R5641:Sbf2	UTSW	7	110438901	missense	probably damaging	1.00
R5915:Sbf2	UTSW	7	110378096	nonsense	probably null
R5948:Sbf2	UTSW	7	110489285	missense	probably damaging	1.00
R5977:Sbf2	UTSW	7	110377986	missense	probably benign	0.00
R6052:Sbf2	UTSW	7	110441534	missense	probably damaging	1.00
R6142:Sbf2	UTSW	7	110348975	missense	probably damaging	1.00
R6327:Sbf2	UTSW	7	110441552	missense	probably damaging	1.00
R6356:Sbf2	UTSW	7	110372623	missense	probably damaging	1.00
R6450:Sbf2	UTSW	7	110462863	missense	probably damaging	1.00
R6587:Sbf2	UTSW	7	110440975	missense	probably damaging	1.00
R6696:Sbf2	UTSW	7	110560298	missense	probably benign	0.04
R6986:Sbf2	UTSW	7	110330615	missense	probably damaging	0.99
R7147:Sbf2	UTSW	7	110447061	missense	probably benign	0.01
R7358:Sbf2	UTSW	7	110399348	missense	possibly damaging	0.95
R7414:Sbf2	UTSW	7	110314064	missense	possibly damaging	0.89
R7418:Sbf2	UTSW	7	110365821	missense	probably damaging	1.00
R7423:Sbf2	UTSW	7	110438848	missense	possibly damaging	0.48
R7425:Sbf2	UTSW	7	110375777	nonsense	probably null
R7431:Sbf2	UTSW	7	110351750	missense	probably damaging	1.00
R7556:Sbf2	UTSW	7	110314053	missense	probably benign	0.20
R7604:Sbf2	UTSW	7	110378067	missense	possibly damaging	0.95
R7707:Sbf2	UTSW	7	110330713	critical splice acceptor site	probably null
R7746:Sbf2	UTSW	7	110441426	missense	probably benign	0.01
R7812:Sbf2	UTSW	7	110449963	missense	possibly damaging	0.84
R7849:Sbf2	UTSW	7	110372510	missense	probably damaging	1.00
R8026:Sbf2	UTSW	7	110335387	missense	probably damaging	1.00
R8048:Sbf2	UTSW	7	110315082	missense	probably benign	0.21
R8305:Sbf2	UTSW	7	110371618	missense	possibly damaging	0.79
R8337:Sbf2	UTSW	7	110441462	missense	probably benign
R8773:Sbf2	UTSW	7	110348995	missense	probably benign
R8786:Sbf2	UTSW	7	110464586	critical splice donor site	probably null
R8812:Sbf2	UTSW	7	110329862	missense	probably damaging	1.00
R8876:Sbf2	UTSW	7	110449939	missense	probably damaging	0.99
R8932:Sbf2	UTSW	7	110440948	critical splice donor site	probably null
R8954:Sbf2	UTSW	7	110438911	nonsense	probably null
R8991:Sbf2	UTSW	7	110312689	missense	probably benign	0.20
R9119:Sbf2	UTSW	7	110312085	missense	possibly damaging	0.93
R9310:Sbf2	UTSW	7	110315085	missense	possibly damaging	0.58
R9344:Sbf2	UTSW	7	110341328	missense	probably benign	0.10
R9346:Sbf2	UTSW	7	110320739	missense	probably benign	0.05
R9404:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9406:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9408:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9472:Sbf2	UTSW	7	110371591	missense	possibly damaging	0.88
R9554:Sbf2	UTSW	7	110441464	missense	probably damaging	1.00
R9562:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9624:Sbf2	UTSW	7	110364650	missense	probably damaging	1.00
R9652:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9653:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9709:Sbf2	UTSW	7	110428307	missense	probably damaging	0.99
RF005:Sbf2	UTSW	7	110317008	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TATCCCTAGGAGCCTCGTAC -3'
(R):5'- TTGTCAAACATGGCTGAAGCG -3'

Sequencing Primer
(F):5'- CTAGGAGCCTCGTACAGTGTG -3'
(R):5'- TGAAGCGCCGCTGCTAC -3'

Posted On

2019-10-17