Incidental Mutation 'R7497:Sbf2'
ID581133
Institutional Source Beutler Lab
Gene Symbol Sbf2
Ensembl Gene ENSMUSG00000038371
Gene NameSET binding factor 2
SynonymsmMTMH1, 4833411B01Rik, Mtmr13, B430219L04Rik, SBF2
MMRRC Submission
Accession Numbers

Genbank: NM_177324; MGI: 1921831

Is this an essential gene? Possibly non essential (E-score: 0.408) question?
Stock #R7497 (G1)
Quality Score103.008
Status Validated
Chromosome7
Chromosomal Location110308013-110614922 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 110614716 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 16 (E16*)
Ref Sequence ENSEMBL: ENSMUSP00000129805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033058] [ENSMUST00000164759] [ENSMUST00000166020] [ENSMUST00000167652] [ENSMUST00000171218]
Predicted Effect probably null
Transcript: ENSMUST00000033058
AA Change: E16*
SMART Domains Protein: ENSMUSP00000033058
Gene: ENSMUSG00000038371
AA Change: E16*

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 420 2e-20 SMART
Pfam:SBF2 530 752 3.3e-106 PFAM
GRAM 869 955 1.3e-12 SMART
low complexity region 1078 1089 N/A INTRINSIC
Pfam:Myotub-related 1091 1544 8.3e-86 PFAM
PH 1767 1872 3.05e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000164759
AA Change: E16*
SMART Domains Protein: ENSMUSP00000132072
Gene: ENSMUSG00000038371
AA Change: E16*

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 420 2e-20 SMART
Pfam:SBF2 528 752 1.6e-107 PFAM
GRAM 869 955 1.3e-12 SMART
Pfam:Myotub-related 1089 1521 1.6e-98 PFAM
PH 1742 1847 3.05e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166020
AA Change: E16*
SMART Domains Protein: ENSMUSP00000126217
Gene: ENSMUSG00000038371
AA Change: E16*

DomainStartEndE-ValueType
uDENN 1 75 9.26e-1 SMART
DENN 70 252 5.68e-75 SMART
dDENN 305 374 2e-20 SMART
Pfam:SBF2 482 706 1.6e-107 PFAM
GRAM 823 909 1.3e-12 SMART
Pfam:Myotub-related 1043 1500 5.9e-98 PFAM
PH 1721 1826 3.05e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167652
AA Change: E16*
Predicted Effect probably null
Transcript: ENSMUST00000171218
AA Change: E16*
SMART Domains Protein: ENSMUSP00000129805
Gene: ENSMUSG00000038371
AA Change: E16*

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 407 1.5e-1 SMART
Meta Mutation Damage Score 0.9664 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudophosphatase and member of the myotubularin-related protein family. This gene maps within the CMT4B2 candidate region of chromosome 11p15 and mutations in this gene have been associated with Charcot-Marie-Tooth Disease, type 4B2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null alleles display progressive misfolding of myelin sheaths and abnormal nerve electrophysiology. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T A 15: 91,191,176 I145F probably benign Het
Acvr2b T A 9: 119,433,286 V455E probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Agap2 T C 10: 127,090,965 V977A probably damaging Het
Als2cr12 T A 1: 58,678,308 D148V probably damaging Het
Aph1b A C 9: 66,794,119 S79A probably damaging Het
Atm G A 9: 53,511,891 S645L probably benign Het
Ccdc173 A C 2: 69,758,448 N439K probably benign Het
Cdh11 T C 8: 102,673,824 R171G probably benign Het
Ces2f T A 8: 104,954,698 D556E probably benign Het
Cyp26b1 C A 6: 84,576,982 V218L possibly damaging Het
D11Wsu47e T A 11: 113,692,397 W517R probably damaging Het
Diaph1 T C 18: 37,895,300 probably null Het
Dock1 A G 7: 134,765,274 I482V probably benign Het
Dok4 A T 8: 94,867,425 D47E possibly damaging Het
Dqx1 T A 6: 83,059,047 L120Q probably damaging Het
Duxf3 A T 10: 58,230,736 V157E probably damaging Het
Eif2a C A 3: 58,548,681 P367Q probably damaging Het
Elp2 C T 18: 24,611,928 R102C probably damaging Het
Erich2 T C 2: 70,534,322 S347P probably damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,735,422 probably null Het
Gadl1 A T 9: 116,074,087 I495L probably benign Het
Gcnt4 A G 13: 96,946,960 T255A possibly damaging Het
Gm10972 A G 3: 94,643,580 K21E unknown Het
Gm11639 T C 11: 104,762,690 probably null Het
Gm7361 C A 5: 26,261,190 H183Q probably benign Het
Gp2 C T 7: 119,454,606 C44Y probably damaging Het
Hcar2 C T 5: 123,865,186 V85I probably benign Het
Hira T C 16: 18,952,079 V822A probably damaging Het
Ighv1-5 T A 12: 114,513,536 T49S probably damaging Het
Ints1 C T 5: 139,768,976 V603M probably damaging Het
Kdm2a A C 19: 4,324,376 L909R probably damaging Het
Klkb1 T A 8: 45,294,790 probably benign Het
Krit1 A G 5: 3,812,349 H168R possibly damaging Het
Map3k21 A T 8: 125,927,601 E386D probably damaging Het
Muc16 C T 9: 18,645,089 E3303K unknown Het
Muc5b T G 7: 141,861,513 V2732G possibly damaging Het
Myo5a T C 9: 75,197,701 L189P Het
Nlrc5 T C 8: 94,521,970 L1740S probably damaging Het
Nolc1 A G 19: 46,082,818 K402R probably benign Het
Olfr1272 T A 2: 90,281,754 T274S possibly damaging Het
Olfr52 T C 2: 86,182,073 I13V probably benign Het
Olfr601 T C 7: 103,359,012 M61V probably damaging Het
Olfr727 T A 14: 50,127,495 L306Q probably benign Het
Pnmal2 A G 7: 16,944,949 probably benign Het
Pnpt1 A T 11: 29,130,860 M35L probably benign Het
Postn A G 3: 54,362,670 K57E probably damaging Het
Ppp1r9a A C 6: 4,905,775 D110A probably damaging Het
Pptc7 G A 5: 122,284,879 V71M possibly damaging Het
Prdm11 T A 2: 93,012,707 I136F possibly damaging Het
Rfc1 A G 5: 65,279,498 L613P probably damaging Het
Ryr3 T C 2: 112,730,473 D2981G probably benign Het
Scara3 T C 14: 65,931,202 E322G probably damaging Het
Sema5b T A 16: 35,661,330 C893S probably damaging Het
Setdb1 T C 3: 95,341,828 D323G probably damaging Het
Slc19a3 T C 1: 83,013,928 Y453C probably damaging Het
Snx5 T C 2: 144,257,974 K137E probably damaging Het
Taar8c G A 10: 24,101,218 T232I probably benign Het
Taok2 G A 7: 126,874,878 T352I probably damaging Het
Ttc3 C A 16: 94,418,682 R489S possibly damaging Het
Usp12 A T 5: 146,752,454 probably null Het
Usp16 T A 16: 87,466,286 C125* probably null Het
Vmn2r106 C T 17: 20,267,939 E733K probably damaging Het
Vps13b T A 15: 35,876,697 I2832K probably benign Het
Vps13c A G 9: 67,840,479 Y18C probably damaging Het
Zfp160 T A 17: 21,026,193 I335K probably benign Het
Zfp788 A T 7: 41,648,851 I304F possibly damaging Het
Other mutations in Sbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sbf2 APN 7 110375832 splice site probably benign
IGL01089:Sbf2 APN 7 110348962 missense probably damaging 1.00
IGL01144:Sbf2 APN 7 110329903 missense probably damaging 1.00
IGL01652:Sbf2 APN 7 110447120 missense probably damaging 1.00
IGL01950:Sbf2 APN 7 110365825 missense probably benign 0.00
IGL02027:Sbf2 APN 7 110461141 missense probably damaging 1.00
IGL02244:Sbf2 APN 7 110560295 missense probably damaging 1.00
IGL02376:Sbf2 APN 7 110462956 missense probably damaging 0.99
IGL03405:Sbf2 APN 7 110462932 missense probably damaging 0.98
N/A - 535:Sbf2 UTSW 7 110312752 missense probably benign
R0084:Sbf2 UTSW 7 110442366 missense possibly damaging 0.95
R0092:Sbf2 UTSW 7 110320806 splice site probably benign
R0121:Sbf2 UTSW 7 110489219 critical splice donor site probably null
R0464:Sbf2 UTSW 7 110464576 splice site probably benign
R0505:Sbf2 UTSW 7 110399343 missense probably damaging 1.00
R0531:Sbf2 UTSW 7 110367323 splice site probably benign
R0554:Sbf2 UTSW 7 110428287 missense probably damaging 1.00
R0617:Sbf2 UTSW 7 110330683 frame shift probably null
R0619:Sbf2 UTSW 7 110310262 missense possibly damaging 0.87
R0799:Sbf2 UTSW 7 110341355 missense possibly damaging 0.58
R0898:Sbf2 UTSW 7 110371652 missense possibly damaging 0.59
R1077:Sbf2 UTSW 7 110367172 splice site probably benign
R1167:Sbf2 UTSW 7 110364549 missense probably damaging 1.00
R1169:Sbf2 UTSW 7 110310184 missense probably benign 0.04
R1424:Sbf2 UTSW 7 110315026 missense probably damaging 1.00
R1536:Sbf2 UTSW 7 110378043 missense probably damaging 1.00
R1558:Sbf2 UTSW 7 110428346 missense probably damaging 1.00
R1601:Sbf2 UTSW 7 110340076 critical splice acceptor site probably null
R1762:Sbf2 UTSW 7 110312758 missense probably benign
R1771:Sbf2 UTSW 7 110461146 nonsense probably null
R1989:Sbf2 UTSW 7 110348923 missense possibly damaging 0.94
R2109:Sbf2 UTSW 7 110461212 missense probably damaging 1.00
R2126:Sbf2 UTSW 7 110560295 missense probably damaging 1.00
R2444:Sbf2 UTSW 7 110330698 missense probably benign 0.31
R3765:Sbf2 UTSW 7 110375581 missense probably damaging 1.00
R3808:Sbf2 UTSW 7 110489280 makesense probably null
R3895:Sbf2 UTSW 7 110447091 missense probably damaging 0.99
R3978:Sbf2 UTSW 7 110329885 missense probably benign 0.00
R4056:Sbf2 UTSW 7 110441466 missense probably damaging 0.99
R4057:Sbf2 UTSW 7 110441466 missense probably damaging 0.99
R4111:Sbf2 UTSW 7 110428242 missense probably damaging 1.00
R4569:Sbf2 UTSW 7 110348853 critical splice donor site probably null
R4670:Sbf2 UTSW 7 110335399 missense probably damaging 1.00
R4763:Sbf2 UTSW 7 110420917 missense probably damaging 1.00
R4792:Sbf2 UTSW 7 110351610 missense probably damaging 0.98
R4811:Sbf2 UTSW 7 110372535 missense probably damaging 1.00
R4822:Sbf2 UTSW 7 110377939 intron probably benign
R5110:Sbf2 UTSW 7 110364657 missense probably benign 0.10
R5143:Sbf2 UTSW 7 110422540 nonsense probably null
R5443:Sbf2 UTSW 7 110377928 intron probably benign
R5457:Sbf2 UTSW 7 110312830 missense probably benign
R5641:Sbf2 UTSW 7 110438901 missense probably damaging 1.00
R5915:Sbf2 UTSW 7 110378096 nonsense probably null
R5948:Sbf2 UTSW 7 110489285 missense probably damaging 1.00
R5977:Sbf2 UTSW 7 110377986 missense probably benign 0.00
R6052:Sbf2 UTSW 7 110441534 missense probably damaging 1.00
R6142:Sbf2 UTSW 7 110348975 missense probably damaging 1.00
R6327:Sbf2 UTSW 7 110441552 missense probably damaging 1.00
R6356:Sbf2 UTSW 7 110372623 missense probably damaging 1.00
R6450:Sbf2 UTSW 7 110462863 missense probably damaging 1.00
R6587:Sbf2 UTSW 7 110440975 missense probably damaging 1.00
R6696:Sbf2 UTSW 7 110560298 missense probably benign 0.04
R6986:Sbf2 UTSW 7 110330615 missense probably damaging 0.99
R7147:Sbf2 UTSW 7 110447061 missense probably benign 0.01
R7358:Sbf2 UTSW 7 110399348 missense possibly damaging 0.95
R7414:Sbf2 UTSW 7 110314064 missense possibly damaging 0.89
R7418:Sbf2 UTSW 7 110365821 missense probably damaging 1.00
R7423:Sbf2 UTSW 7 110438848 missense possibly damaging 0.48
R7425:Sbf2 UTSW 7 110375777 nonsense probably null
R7431:Sbf2 UTSW 7 110351750 missense probably damaging 1.00
R7556:Sbf2 UTSW 7 110314053 missense probably benign 0.20
R7604:Sbf2 UTSW 7 110378067 missense possibly damaging 0.95
R7707:Sbf2 UTSW 7 110330713 critical splice acceptor site probably null
R7746:Sbf2 UTSW 7 110441426 missense probably benign 0.01
R7812:Sbf2 UTSW 7 110449963 missense possibly damaging 0.84
R7849:Sbf2 UTSW 7 110372510 missense probably damaging 1.00
R8026:Sbf2 UTSW 7 110335387 missense probably damaging 1.00
R8048:Sbf2 UTSW 7 110315082 missense probably benign 0.21
R8305:Sbf2 UTSW 7 110371618 missense possibly damaging 0.79
R8337:Sbf2 UTSW 7 110441462 missense probably benign
RF005:Sbf2 UTSW 7 110317008 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCCCTAGGAGCCTCGTAC -3'
(R):5'- TTGTCAAACATGGCTGAAGCG -3'

Sequencing Primer
(F):5'- CTAGGAGCCTCGTACAGTGTG -3'
(R):5'- TGAAGCGCCGCTGCTAC -3'
Posted On2019-10-17