Incidental Mutation 'R0634:Olfr530'
ID58150
Institutional Source Beutler Lab
Gene Symbol Olfr530
Ensembl Gene ENSMUSG00000060974
Gene Nameolfactory receptor 530
SynonymsGA_x6K02T2PBJ9-42523824-42522901, MOR252-2
MMRRC Submission 038823-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R0634 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140371872-140376331 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 140373397 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 71 (V71E)
Ref Sequence ENSEMBL: ENSMUSP00000149475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074177] [ENSMUST00000216727]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074177
AA Change: V71E

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073808
Gene: ENSMUSG00000060974
AA Change: V71E

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 4.8e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 304 1.8e-6 PFAM
Pfam:7tm_1 41 289 1.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211097
Predicted Effect possibly damaging
Transcript: ENSMUST00000216727
AA Change: V71E

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,314,491 I2958V possibly damaging Het
Adam21 C A 12: 81,560,352 W212L probably benign Het
Adcy2 A C 13: 68,727,945 H479Q possibly damaging Het
Adcy4 T C 14: 55,781,597 R168G probably benign Het
Atp13a2 T C 4: 141,006,929 probably benign Het
C1ra G A 6: 124,517,505 E304K possibly damaging Het
C87977 A G 4: 144,209,340 probably null Het
Cc2d2a A C 5: 43,681,381 probably benign Het
Cenpe T C 3: 135,246,827 L1426P probably damaging Het
Cntn1 A T 15: 92,314,563 R869* probably null Het
Creb3l2 A T 6: 37,334,348 probably benign Het
Crybg2 G A 4: 134,075,304 probably benign Het
Csmd1 A T 8: 16,226,391 F800I probably damaging Het
Dock6 G A 9: 21,841,527 T330I probably damaging Het
Ets2 G A 16: 95,716,156 E311K possibly damaging Het
Fbxo22 A T 9: 55,214,960 Q141L probably benign Het
Fer C T 17: 64,035,508 T223M probably benign Het
Gm13757 A T 2: 88,446,617 M107K probably benign Het
Gm9774 C T 3: 92,428,809 W125* probably null Het
Gtf3c1 A T 7: 125,657,477 probably benign Het
Gtf3c2 G A 5: 31,159,806 R684* probably null Het
Hs6st3 T A 14: 119,869,062 L294* probably null Het
Ighg2c T G 12: 113,287,964 E181A unknown Het
Igkv6-15 A T 6: 70,406,779 probably benign Het
Lrmp A T 6: 145,174,628 H523L probably damaging Het
Map2k6 C T 11: 110,494,343 R178* probably null Het
Meikin T A 11: 54,390,483 D126E probably benign Het
Mgst1 A T 6: 138,156,331 T37S probably damaging Het
Mrc2 G A 11: 105,347,692 V1222M probably benign Het
Myom2 C A 8: 15,119,216 probably benign Het
Negr1 A G 3: 157,016,266 K159R possibly damaging Het
Nptx1 T C 11: 119,543,301 T320A possibly damaging Het
Olfr490 T C 7: 108,286,296 I277V probably benign Het
Pes1 C T 11: 3,977,794 probably benign Het
Pes1 T G 11: 3,977,795 probably benign Het
Pkhd1 A T 1: 20,117,474 Y3537N probably damaging Het
Poteg G A 8: 27,473,587 G289R probably benign Het
Rassf5 T C 1: 131,244,956 R59G probably damaging Het
Reln A T 5: 22,018,869 W961R probably damaging Het
Rhot2 G A 17: 25,842,028 H168Y possibly damaging Het
Ripk3 G T 14: 55,788,391 probably benign Het
Samm50 A G 15: 84,214,171 silent Het
Sap30bp T C 11: 115,957,403 I117T probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Sipa1l2 A T 8: 125,422,624 L1632* probably null Het
Sirt7 T C 11: 120,622,129 probably benign Het
Smg8 T C 11: 87,086,108 T216A possibly damaging Het
Sox9 A G 11: 112,784,942 Y319C probably damaging Het
Sspn G A 6: 145,961,151 A27T possibly damaging Het
Suco A G 1: 161,838,804 V509A possibly damaging Het
Svep1 C T 4: 58,070,661 C2375Y possibly damaging Het
Trbv21 T A 6: 41,203,050 probably benign Het
Uimc1 C T 13: 55,060,266 E455K possibly damaging Het
Upk3b A G 5: 136,040,076 T100A possibly damaging Het
Usp47 A G 7: 112,108,655 N1303D probably damaging Het
Vav1 A T 17: 57,303,862 D476V probably benign Het
Vmn1r68 A G 7: 10,527,235 V312A probably benign Het
Wdr62 A G 7: 30,270,174 V287A probably damaging Het
Zcchc4 C T 5: 52,783,208 P40S probably benign Het
Zfp326 T A 5: 105,886,203 Y26* probably null Het
Zfp592 A G 7: 81,038,071 H915R probably damaging Het
Other mutations in Olfr530
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Olfr530 APN 7 140373185 missense probably benign 0.01
IGL01785:Olfr530 APN 7 140373125 missense probably benign
IGL01786:Olfr530 APN 7 140373125 missense probably benign
IGL03087:Olfr530 APN 7 140373092 missense probably damaging 1.00
R0543:Olfr530 UTSW 7 140373394 missense probably benign 0.07
R1470:Olfr530 UTSW 7 140373113 missense probably benign 0.03
R1470:Olfr530 UTSW 7 140373113 missense probably benign 0.03
R1553:Olfr530 UTSW 7 140373038 missense probably damaging 1.00
R1702:Olfr530 UTSW 7 140372742 nonsense probably null
R1767:Olfr530 UTSW 7 140373476 missense possibly damaging 0.95
R2379:Olfr530 UTSW 7 140372835 nonsense probably null
R4243:Olfr530 UTSW 7 140372944 missense probably benign 0.01
R4281:Olfr530 UTSW 7 140373472 missense probably benign 0.10
R4717:Olfr530 UTSW 7 140373415 missense probably damaging 0.99
R4923:Olfr530 UTSW 7 140373007 missense probably benign 0.11
R5763:Olfr530 UTSW 7 140373655 critical splice acceptor site probably null
R6126:Olfr530 UTSW 7 140373253 missense probably damaging 1.00
R6528:Olfr530 UTSW 7 140373441 missense possibly damaging 0.81
R7469:Olfr530 UTSW 7 140373137 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACAAAGGTTGCAAGGGCCACAC -3'
(R):5'- TGCAAAGGTTTGTTGATGACCCCTG -3'

Sequencing Primer
(F):5'- CATGAGGGTGCCATAGTGC -3'
(R):5'- CTGATCATCGCAACCATCCA -3'
Posted On2013-07-11