Incidental Mutation 'R6528:Olfr530'
ID522076
Institutional Source Beutler Lab
Gene Symbol Olfr530
Ensembl Gene ENSMUSG00000060974
Gene Nameolfactory receptor 530
SynonymsGA_x6K02T2PBJ9-42523824-42522901, MOR252-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R6528 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location140371872-140376331 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 140373441 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 56 (H56Q)
Ref Sequence ENSEMBL: ENSMUSP00000149475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074177] [ENSMUST00000216727]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074177
AA Change: H56Q

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073808
Gene: ENSMUSG00000060974
AA Change: H56Q

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 4.8e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 304 1.8e-6 PFAM
Pfam:7tm_1 41 289 1.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211097
Predicted Effect possibly damaging
Transcript: ENSMUST00000216727
AA Change: H56Q

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 C T 8: 55,872,561 R286H possibly damaging Het
Arhgap29 T A 3: 122,014,702 N1176K probably benign Het
C87977 A G 4: 144,208,811 V120A probably damaging Het
Cacfd1 T G 2: 27,018,939 D97E probably benign Het
Ccnj C A 19: 40,832,085 probably null Het
Chad A G 11: 94,565,624 Y176C probably damaging Het
Chd5 T C 4: 152,356,676 L191P probably damaging Het
Cmtm1 T C 8: 104,309,295 D190G possibly damaging Het
Cyp3a16 C T 5: 145,440,431 A449T probably damaging Het
Eml5 T C 12: 98,824,637 E1334G probably benign Het
Endou C T 15: 97,719,629 E147K probably damaging Het
Fbxo21 C A 5: 118,000,356 H449N probably benign Het
Fkbp15 A G 4: 62,332,270 I363T probably damaging Het
Gm12887 C A 4: 121,615,637 G103C probably damaging Het
Gm14410 T A 2: 177,193,508 H321L probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Irgm2 C T 11: 58,220,052 P202S probably benign Het
Khsrp G A 17: 57,023,543 T551I probably damaging Het
Lpin2 T A 17: 71,244,005 I720N probably damaging Het
Lypd8 G A 11: 58,384,613 G58E probably damaging Het
Mdn1 G T 4: 32,713,780 L1952F probably damaging Het
Med13 G A 11: 86,298,954 P1043L probably damaging Het
Mycbp2 T C 14: 103,142,881 T3832A probably damaging Het
Nrxn3 C T 12: 89,513,049 R654C probably damaging Het
Olfr1082 T C 2: 86,594,465 D121G probably damaging Het
Olfr512 T C 7: 108,713,431 L14P probably damaging Het
Olfr535 A G 7: 140,493,051 M138V probably damaging Het
Pcdhb6 A G 18: 37,334,503 D159G probably damaging Het
Plec T C 15: 76,174,430 E3759G probably damaging Het
Plekho1 C T 3: 95,989,321 D236N probably damaging Het
Pnma1 T A 12: 84,147,423 I169F probably benign Het
Ppl T A 16: 5,087,616 H1605L probably benign Het
Ppp2r2b T A 18: 42,688,338 M252L probably benign Het
Prickle4 T A 17: 47,689,333 R246* probably null Het
Rad50 G A 11: 53,652,282 T1235I probably damaging Het
Ranbp10 T C 8: 105,779,956 N244S probably damaging Het
Robo4 T C 9: 37,404,368 S306P possibly damaging Het
Shox2 C A 3: 66,981,285 R91L probably benign Het
Tbx5 A G 5: 119,883,111 E394G probably damaging Het
Tcl1b5 A G 12: 105,178,999 N74S probably benign Het
Tgif1 G A 17: 70,846,560 probably benign Het
Tmem128 T A 5: 38,266,499 probably null Het
Trio A G 15: 27,805,870 S511P probably damaging Het
Trps1 A G 15: 50,822,427 I114T probably benign Het
Ttll8 G T 15: 88,914,238 Q765K probably benign Het
Usp17ld A T 7: 103,250,755 D323E probably damaging Het
Vmn1r232 G A 17: 20,914,047 T97I probably benign Het
Vmn2r28 T A 7: 5,490,685 R87S probably benign Het
Vps26b C G 9: 27,010,466 E254D probably benign Het
Vps8 C A 16: 21,554,125 Y113* probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xcr1 A T 9: 123,855,983 I238N probably damaging Het
Zar1l T A 5: 150,507,130 E272V probably damaging Het
Zfp451 A G 1: 33,777,781 Y146H probably damaging Het
Zfp54 G T 17: 21,433,474 E77* probably null Het
Other mutations in Olfr530
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Olfr530 APN 7 140373185 missense probably benign 0.01
IGL01785:Olfr530 APN 7 140373125 missense probably benign
IGL01786:Olfr530 APN 7 140373125 missense probably benign
IGL03087:Olfr530 APN 7 140373092 missense probably damaging 1.00
R0543:Olfr530 UTSW 7 140373394 missense probably benign 0.07
R0634:Olfr530 UTSW 7 140373397 missense possibly damaging 0.88
R1470:Olfr530 UTSW 7 140373113 missense probably benign 0.03
R1470:Olfr530 UTSW 7 140373113 missense probably benign 0.03
R1553:Olfr530 UTSW 7 140373038 missense probably damaging 1.00
R1702:Olfr530 UTSW 7 140372742 nonsense probably null
R1767:Olfr530 UTSW 7 140373476 missense possibly damaging 0.95
R2379:Olfr530 UTSW 7 140372835 nonsense probably null
R4243:Olfr530 UTSW 7 140372944 missense probably benign 0.01
R4281:Olfr530 UTSW 7 140373472 missense probably benign 0.10
R4717:Olfr530 UTSW 7 140373415 missense probably damaging 0.99
R4923:Olfr530 UTSW 7 140373007 missense probably benign 0.11
R5763:Olfr530 UTSW 7 140373655 critical splice acceptor site probably null
R6126:Olfr530 UTSW 7 140373253 missense probably damaging 1.00
R7469:Olfr530 UTSW 7 140373137 missense possibly damaging 0.93
R8081:Olfr530 UTSW 7 140373059 missense probably damaging 1.00
Z1177:Olfr530 UTSW 7 140372803 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CCGACAGATTGCAAGGTAGC -3'
(R):5'- AACCTAGACAGTGTTTCCCATGG -3'

Sequencing Primer
(F):5'- TAGCGGTCATAGGCCATGG -3'
(R):5'- GTTTCCCATGGCGCTGGTAAAC -3'
Posted On2018-06-06