Incidental Mutation 'R7544:Capn7'
ID 584113
Institutional Source Beutler Lab
Gene Symbol Capn7
Ensembl Gene ENSMUSG00000021893
Gene Name calpain 7
Synonyms PalBH
MMRRC Submission 045616-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.848) question?
Stock # R7544 (G1)
Quality Score 205.009
Status Not validated
Chromosome 14
Chromosomal Location 31058595-31093943 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 31062007 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 40 (L40V)
Ref Sequence ENSEMBL: ENSMUSP00000022451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022451] [ENSMUST00000143472] [ENSMUST00000152182]
AlphaFold Q9R1S8
Predicted Effect probably damaging
Transcript: ENSMUST00000022451
AA Change: L40V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022451
Gene: ENSMUSG00000021893
AA Change: L40V

DomainStartEndE-ValueType
MIT 3 77 1.54e0 SMART
MIT 83 160 1.07e-17 SMART
CysPc 218 547 1.08e-91 SMART
Blast:CysPc 550 620 4e-39 BLAST
calpain_III 686 810 2.78e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143472
AA Change: L40V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118596
Gene: ENSMUSG00000021893
AA Change: L40V

DomainStartEndE-ValueType
MIT 3 77 1.54e0 SMART
MIT 83 160 1.07e-17 SMART
CysPc 218 500 2.32e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152182
AA Change: L40V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119214
Gene: ENSMUSG00000021893
AA Change: L40V

DomainStartEndE-ValueType
MIT 3 77 1.54e0 SMART
MIT 83 160 1.07e-17 SMART
CysPc 218 500 2.32e-50 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains are ubiquitous, well-conserved family of calcium-dependent, cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large subunit possesses a cysteine protease domain, and both subunits possess calcium-binding domains. Calpains have been implicated in neurodegenerative processes, as their activation can be triggered by calcium influx and oxidative stress. The function of the protein encoded by this gene is not known. An orthologue has been found in mouse but it seems to diverge from other family members. The mouse orthologue is thought to be calcium independent with protease activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene frequently die before weaning. Survivors display reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C T 11: 72,089,765 (GRCm39) V40I probably damaging Het
Abcb11 T C 2: 69,095,830 (GRCm39) K837E probably benign Het
Arhgef10 T C 8: 15,029,854 (GRCm39) S919P probably benign Het
Atxn2 T C 5: 121,919,431 (GRCm39) S530P probably damaging Het
Bicc1 T C 10: 70,792,204 (GRCm39) E268G possibly damaging Het
Bnip5 G A 17: 29,124,298 (GRCm39) R335W probably damaging Het
Cd28 A T 1: 60,808,859 (GRCm39) N191I probably damaging Het
Cfap69 G A 5: 5,645,936 (GRCm39) T588M not run Het
Csmd1 T C 8: 16,142,310 (GRCm39) E1531G probably damaging Het
Cyp4a14 T A 4: 115,348,283 (GRCm39) D398V probably damaging Het
Dchs2 T C 3: 83,262,434 (GRCm39) S2901P probably damaging Het
Ddx11 G A 17: 66,433,280 (GRCm39) G37S probably damaging Het
Diaph1 A T 18: 38,026,322 (GRCm39) probably null Het
Ech1 T C 7: 28,525,392 (GRCm39) V49A probably benign Het
Elovl4 T C 9: 83,665,271 (GRCm39) Y196C probably damaging Het
Ern2 G A 7: 121,772,422 (GRCm39) L679F probably benign Het
Fbf1 A T 11: 116,056,659 (GRCm39) M17K probably benign Het
Flvcr1 C A 1: 190,758,143 (GRCm39) G50W probably damaging Het
Fryl A G 5: 73,238,382 (GRCm39) S1455P probably benign Het
Fzd9 A G 5: 135,278,716 (GRCm39) Y390H probably damaging Het
Gnai3 C T 3: 108,025,702 (GRCm39) V126M Het
Gpc5 T C 14: 115,665,585 (GRCm39) F470L probably damaging Het
Grin1 T C 2: 25,195,086 (GRCm39) N332S probably benign Het
Gtf3c5 T A 2: 28,469,554 (GRCm39) I117F possibly damaging Het
Hydin A T 8: 111,316,157 (GRCm39) S4350C probably benign Het
Kcnh4 G T 11: 100,647,906 (GRCm39) H152Q probably benign Het
Kcnk12 A T 17: 88,053,493 (GRCm39) S390T possibly damaging Het
Klra9 T G 6: 130,168,183 (GRCm39) T28P probably benign Het
Lef1 T A 3: 130,988,414 (GRCm39) I327N probably damaging Het
Lin54 A G 5: 100,633,129 (GRCm39) V185A possibly damaging Het
Lrrc37 T C 11: 103,506,274 (GRCm39) E1898G probably benign Het
Lrrc4b A T 7: 44,111,975 (GRCm39) I616F probably damaging Het
Mad2l1bp A G 17: 46,463,770 (GRCm39) Y85H possibly damaging Het
Mars1 T C 10: 127,147,479 (GRCm39) E7G probably benign Het
Mpnd G A 17: 56,318,666 (GRCm39) R225H probably benign Het
Muc4 T A 16: 32,555,016 (GRCm39) M1K probably null Het
Nckap5 A G 1: 125,953,948 (GRCm39) L868S possibly damaging Het
Ndst1 G A 18: 60,830,256 (GRCm39) T618M probably damaging Het
Npas1 A T 7: 16,194,899 (GRCm39) probably null Het
Nr2f2 A T 7: 70,004,499 (GRCm39) V384D probably damaging Het
Or10a3b A G 7: 108,444,528 (GRCm39) S230P probably benign Het
Or1e19 A G 11: 73,316,596 (GRCm39) L71P probably damaging Het
Or4p8 T A 2: 88,727,705 (GRCm39) I79F probably damaging Het
Paip1 T A 13: 119,582,337 (GRCm39) F188I probably damaging Het
Pcdha4 A T 18: 37,086,776 (GRCm39) I320L probably benign Het
Peg10 TCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATC T 6: 4,756,427 (GRCm39) probably null Het
Pgpep1 C T 8: 71,103,168 (GRCm39) G110R unknown Het
Pidd1 T A 7: 141,020,252 (GRCm39) H558L possibly damaging Het
Ppp1r1a C T 15: 103,439,776 (GRCm39) probably null Het
Pramel18 T C 4: 101,768,599 (GRCm39) S317P possibly damaging Het
Pramel51 T A 12: 88,142,850 (GRCm39) Y451F probably benign Het
Prkcg A G 7: 3,359,081 (GRCm39) D96G probably benign Het
Prpf40b A G 15: 99,203,899 (GRCm39) N154S probably benign Het
Psg17 A G 7: 18,553,897 (GRCm39) Y118H probably benign Het
Ptpn12 A G 5: 21,214,509 (GRCm39) I209T probably damaging Het
Reln T A 5: 22,181,276 (GRCm39) K1835* probably null Het
Sf3b3 T C 8: 111,564,915 (GRCm39) M298V probably benign Het
Slc5a3 T A 16: 91,874,682 (GRCm39) N246K probably benign Het
Slmap T A 14: 26,151,001 (GRCm39) E522D probably damaging Het
Slmap C T 14: 26,151,003 (GRCm39) E522K probably damaging Het
Tcp10c T A 17: 13,581,260 (GRCm39) L230Q probably damaging Het
Tdo2 A G 3: 81,878,942 (GRCm39) probably null Het
Tet3 A T 6: 83,381,623 (GRCm39) W182R probably damaging Het
Tmem151a T A 19: 5,121,895 (GRCm39) M35L unknown Het
Tom1l2 TTGATGATG TTGATG 11: 60,171,040 (GRCm39) probably benign Het
Trak2 A T 1: 58,960,227 (GRCm39) probably null Het
Trappc11 T A 8: 47,975,449 (GRCm39) E256D possibly damaging Het
Trim62 C T 4: 128,796,346 (GRCm39) T281I probably benign Het
Trip13 T C 13: 74,081,021 (GRCm39) E115G probably benign Het
Trp63 A G 16: 25,620,837 (GRCm39) T10A probably benign Het
Urah A T 7: 140,415,565 (GRCm39) H11L probably damaging Het
Usp39 G A 6: 72,319,891 (GRCm39) T109I probably damaging Het
Wfikkn2 T C 11: 94,128,738 (GRCm39) T468A probably benign Het
Zfhx4 T G 3: 5,477,875 (GRCm39) S3497A probably damaging Het
Zfp85 C T 13: 67,897,184 (GRCm39) R296H probably benign Het
Other mutations in Capn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Capn7 APN 14 31,085,535 (GRCm39) missense probably benign 0.41
IGL01481:Capn7 APN 14 31,077,296 (GRCm39) missense probably damaging 1.00
IGL03231:Capn7 APN 14 31,077,247 (GRCm39) missense probably damaging 1.00
R0018:Capn7 UTSW 14 31,076,069 (GRCm39) nonsense probably null
R0018:Capn7 UTSW 14 31,076,069 (GRCm39) nonsense probably null
R0060:Capn7 UTSW 14 31,087,561 (GRCm39) splice site probably benign
R0060:Capn7 UTSW 14 31,087,561 (GRCm39) splice site probably benign
R0077:Capn7 UTSW 14 31,090,072 (GRCm39) missense probably benign 0.10
R0195:Capn7 UTSW 14 31,087,538 (GRCm39) missense probably damaging 1.00
R0316:Capn7 UTSW 14 31,069,766 (GRCm39) missense probably benign 0.00
R0815:Capn7 UTSW 14 31,091,714 (GRCm39) missense possibly damaging 0.85
R0863:Capn7 UTSW 14 31,091,714 (GRCm39) missense possibly damaging 0.85
R1697:Capn7 UTSW 14 31,082,117 (GRCm39) missense probably damaging 1.00
R1954:Capn7 UTSW 14 31,082,107 (GRCm39) missense probably damaging 1.00
R2096:Capn7 UTSW 14 31,071,844 (GRCm39) critical splice donor site probably null
R3121:Capn7 UTSW 14 31,081,167 (GRCm39) missense probably damaging 1.00
R3122:Capn7 UTSW 14 31,081,167 (GRCm39) missense probably damaging 1.00
R4409:Capn7 UTSW 14 31,077,296 (GRCm39) missense probably damaging 1.00
R4676:Capn7 UTSW 14 31,081,216 (GRCm39) missense possibly damaging 0.72
R4799:Capn7 UTSW 14 31,082,514 (GRCm39) missense probably benign 0.01
R5023:Capn7 UTSW 14 31,074,383 (GRCm39) missense probably damaging 0.99
R5129:Capn7 UTSW 14 31,066,468 (GRCm39) missense probably damaging 0.99
R5460:Capn7 UTSW 14 31,090,160 (GRCm39) critical splice donor site probably null
R5608:Capn7 UTSW 14 31,092,664 (GRCm39) missense probably damaging 1.00
R5665:Capn7 UTSW 14 31,091,759 (GRCm39) missense probably benign 0.00
R5786:Capn7 UTSW 14 31,082,102 (GRCm39) missense probably damaging 1.00
R6186:Capn7 UTSW 14 31,092,875 (GRCm39) missense probably damaging 1.00
R6190:Capn7 UTSW 14 31,085,560 (GRCm39) missense probably benign 0.10
R6411:Capn7 UTSW 14 31,062,053 (GRCm39) missense probably benign 0.00
R6514:Capn7 UTSW 14 31,066,511 (GRCm39) missense probably benign 0.00
R6838:Capn7 UTSW 14 31,076,130 (GRCm39) missense possibly damaging 0.95
R7041:Capn7 UTSW 14 31,058,642 (GRCm39) unclassified probably benign
R7047:Capn7 UTSW 14 31,058,642 (GRCm39) unclassified probably benign
R7124:Capn7 UTSW 14 31,058,642 (GRCm39) unclassified probably benign
R7224:Capn7 UTSW 14 31,092,678 (GRCm39) nonsense probably null
R7417:Capn7 UTSW 14 31,092,663 (GRCm39) missense probably damaging 1.00
R7419:Capn7 UTSW 14 31,071,779 (GRCm39) missense probably benign 0.02
R7699:Capn7 UTSW 14 31,074,401 (GRCm39) missense probably benign 0.00
R7700:Capn7 UTSW 14 31,074,401 (GRCm39) missense probably benign 0.00
R7775:Capn7 UTSW 14 31,074,367 (GRCm39) missense probably benign 0.00
R7824:Capn7 UTSW 14 31,074,367 (GRCm39) missense probably benign 0.00
R7908:Capn7 UTSW 14 31,088,202 (GRCm39) critical splice donor site probably null
R8057:Capn7 UTSW 14 31,092,936 (GRCm39) missense probably benign 0.27
R8176:Capn7 UTSW 14 31,069,729 (GRCm39) missense probably benign 0.03
R8270:Capn7 UTSW 14 31,080,636 (GRCm39) missense probably damaging 0.97
R9103:Capn7 UTSW 14 31,091,732 (GRCm39) missense probably benign 0.23
R9732:Capn7 UTSW 14 31,090,031 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAATCACGGCTACTCTGAAGAAG -3'
(R):5'- TGTCAAGATCCAAGGCAGAG -3'

Sequencing Primer
(F):5'- GAAGTGTTTAATAACTGGGTTCTCAG -3'
(R):5'- TCAAGATCCAAGGCAGAGAGACAG -3'
Posted On 2019-10-17