Incidental Mutation 'R0619:Olfr1034'
ID58511
Institutional Source Beutler Lab
Gene Symbol Olfr1034
Ensembl Gene ENSMUSG00000102091
Gene Nameolfactory receptor 1034
SynonymsGA_x6K02T2Q125-47521463-47522395, MOR227-8P, MOR227-8P, Olfr1533-ps1, MOR245-14P
MMRRC Submission 038808-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.456) question?
Stock #R0619 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86045861-86050742 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 86047311 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 276 (Y276*)
Ref Sequence ENSEMBL: ENSMUSP00000150150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079298] [ENSMUST00000213496] [ENSMUST00000213865] [ENSMUST00000214546] [ENSMUST00000215682] [ENSMUST00000218397]
Predicted Effect probably null
Transcript: ENSMUST00000079298
AA Change: Y276*
SMART Domains Protein: ENSMUSP00000078279
Gene: ENSMUSG00000042796
AA Change: Y276*

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.3e-50 PFAM
Pfam:7tm_1 39 288 9.9e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213364
Predicted Effect probably null
Transcript: ENSMUST00000213496
AA Change: Y276*
Predicted Effect probably benign
Transcript: ENSMUST00000213865
Predicted Effect probably benign
Transcript: ENSMUST00000214546
Predicted Effect probably benign
Transcript: ENSMUST00000215682
Predicted Effect probably benign
Transcript: ENSMUST00000218397
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 G A 8: 119,613,000 D74N probably benign Het
Adgre4 T A 17: 55,820,679 V573D possibly damaging Het
Ak7 A G 12: 105,733,511 K230E probably damaging Het
Amdhd2 T C 17: 24,156,588 D375G possibly damaging Het
Anpep T C 7: 79,841,009 E253G probably benign Het
Bbs7 A G 3: 36,607,576 L158S probably benign Het
BC037034 A G 5: 138,263,826 probably benign Het
Bdp1 T C 13: 100,037,858 T2057A probably benign Het
C2 G T 17: 34,872,503 H61Q probably damaging Het
Ccdc18 A G 5: 108,180,416 K661E probably benign Het
Cdh23 C T 10: 60,433,777 V655I probably damaging Het
Cep78 T C 19: 15,978,862 T238A probably damaging Het
Ces2a T A 8: 104,736,110 N110K probably benign Het
Crat T C 2: 30,409,984 D128G probably benign Het
Dclre1a A T 19: 56,545,409 M233K probably benign Het
Dsg4 T C 18: 20,461,359 V515A probably benign Het
Fer1l6 T C 15: 58,662,935 probably null Het
Fryl T C 5: 73,068,731 D1863G probably benign Het
Fsip2 T A 2: 82,944,140 L57Q probably damaging Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Iqsec1 T C 6: 90,670,406 probably null Het
Kcnn3 A C 3: 89,652,030 T536P probably damaging Het
Kctd3 T C 1: 188,978,643 D441G probably damaging Het
Kifc3 G A 8: 95,102,665 T528M probably benign Het
Kmt2c G A 5: 25,298,916 T3798I probably benign Het
Map1a T A 2: 121,305,255 M1946K probably damaging Het
Mfhas1 T A 8: 35,590,675 V768E probably benign Het
Mroh8 C A 2: 157,265,081 V223F possibly damaging Het
Mss51 A T 14: 20,487,573 V30E probably benign Het
Mtmr10 G A 7: 64,321,213 R392H probably benign Het
Mup3 T C 4: 62,085,961 N105S probably benign Het
Myh7b T C 2: 155,611,722 M22T probably benign Het
Olfr170 T A 16: 19,606,272 Y132F probably damaging Het
Olfr97 T A 17: 37,232,155 I72F possibly damaging Het
Os9 A G 10: 127,120,991 I43T probably damaging Het
Pkhd1l1 T C 15: 44,483,838 L200P probably damaging Het
Ptpru C T 4: 131,820,887 V100M possibly damaging Het
Rnf6 G A 5: 146,210,721 R496C possibly damaging Het
Rsad1 C T 11: 94,542,639 R407Q probably damaging Het
Rspo3 T C 10: 29,504,637 D127G probably damaging Het
Sbf2 T A 7: 110,310,262 T1760S possibly damaging Het
Sh2d3c T A 2: 32,753,025 V588E probably damaging Het
Siglech A T 7: 55,769,162 T238S probably benign Het
Slc15a2 T A 16: 36,759,307 N328I probably damaging Het
Slc16a11 G T 11: 70,215,032 G94C probably damaging Het
Stub1 T C 17: 25,831,322 probably null Het
Tacc2 T A 7: 130,716,753 V40D probably damaging Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tsen54 A G 11: 115,815,064 E69G probably damaging Het
Tsks A G 7: 44,950,834 E150G probably damaging Het
Ubap2l A C 3: 90,017,220 V680G probably benign Het
Usp16 A T 16: 87,472,164 H315L probably benign Het
Vav2 A G 2: 27,296,121 probably null Het
Zfc3h1 T C 10: 115,420,810 F1562L possibly damaging Het
Zfp764 C A 7: 127,406,541 V22L probably benign Het
Other mutations in Olfr1034
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Olfr1034 APN 2 86046652 missense possibly damaging 0.55
IGL01066:Olfr1034 APN 2 86047258 missense probably damaging 0.97
IGL01326:Olfr1034 APN 2 86047283 missense probably damaging 0.96
IGL02862:Olfr1034 APN 2 86047304 missense probably benign 0.07
ANU74:Olfr1034 UTSW 2 86047311 nonsense probably null
PIT4651001:Olfr1034 UTSW 2 86046518 missense probably damaging 1.00
R0415:Olfr1034 UTSW 2 86047055 missense probably benign 0.00
R0492:Olfr1034 UTSW 2 86046587 missense probably benign 0.00
R0492:Olfr1034 UTSW 2 86046934 missense possibly damaging 0.81
R0517:Olfr1034 UTSW 2 86047204 missense probably damaging 0.99
R0519:Olfr1034 UTSW 2 86047067 missense probably benign
R1015:Olfr1034 UTSW 2 86047082 missense possibly damaging 0.49
R1592:Olfr1034 UTSW 2 86046989 missense probably benign 0.00
R1598:Olfr1034 UTSW 2 86047313 missense probably damaging 0.99
R2062:Olfr1034 UTSW 2 86046955 missense probably damaging 1.00
R4690:Olfr1034 UTSW 2 86046898 missense probably damaging 1.00
R5757:Olfr1034 UTSW 2 86046566 missense possibly damaging 0.93
R5991:Olfr1034 UTSW 2 86046910 missense probably benign 0.05
R6037:Olfr1034 UTSW 2 86046584 missense probably benign 0.00
R6037:Olfr1034 UTSW 2 86046584 missense probably benign 0.00
R6760:Olfr1034 UTSW 2 86047014 nonsense probably null
R6852:Olfr1034 UTSW 2 86046604 missense probably benign 0.28
S24628:Olfr1034 UTSW 2 86047055 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAGCAAGATGTCCAGGGTTGTC -3'
(R):5'- GCAACCACGCTGTAAAGCATCACTG -3'

Sequencing Primer
(F):5'- CTCATCAAGATTGCCTGTGGAG -3'
(R):5'- GCTGTAAAGCATCACTGTGGATAAC -3'
Posted On2013-07-11