Incidental Mutation 'R0619:Adad2'
ID58540
Institutional Source Beutler Lab
Gene Symbol Adad2
Ensembl Gene ENSMUSG00000024266
Gene Nameadenosine deaminase domain containing 2
Synonyms
MMRRC Submission 038808-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0619 (G1)
Quality Score96
Status Not validated
Chromosome8
Chromosomal Location119612747-119616924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119613000 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 74 (D74N)
Ref Sequence ENSEMBL: ENSMUSP00000095964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098361]
Predicted Effect probably benign
Transcript: ENSMUST00000098361
AA Change: D74N

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000095964
Gene: ENSMUSG00000024266
AA Change: D74N

DomainStartEndE-ValueType
DSRM 94 158 4e-7 SMART
ADEAMc 185 560 2.7e-37 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T A 17: 55,820,679 V573D possibly damaging Het
Ak7 A G 12: 105,733,511 K230E probably damaging Het
Amdhd2 T C 17: 24,156,588 D375G possibly damaging Het
Anpep T C 7: 79,841,009 E253G probably benign Het
Bbs7 A G 3: 36,607,576 L158S probably benign Het
BC037034 A G 5: 138,263,826 probably benign Het
Bdp1 T C 13: 100,037,858 T2057A probably benign Het
C2 G T 17: 34,872,503 H61Q probably damaging Het
Ccdc18 A G 5: 108,180,416 K661E probably benign Het
Cdh23 C T 10: 60,433,777 V655I probably damaging Het
Cep78 T C 19: 15,978,862 T238A probably damaging Het
Ces2a T A 8: 104,736,110 N110K probably benign Het
Crat T C 2: 30,409,984 D128G probably benign Het
Dclre1a A T 19: 56,545,409 M233K probably benign Het
Dsg4 T C 18: 20,461,359 V515A probably benign Het
Fer1l6 T C 15: 58,662,935 probably null Het
Fryl T C 5: 73,068,731 D1863G probably benign Het
Fsip2 T A 2: 82,944,140 L57Q probably damaging Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Iqsec1 T C 6: 90,670,406 probably null Het
Kcnn3 A C 3: 89,652,030 T536P probably damaging Het
Kctd3 T C 1: 188,978,643 D441G probably damaging Het
Kifc3 G A 8: 95,102,665 T528M probably benign Het
Kmt2c G A 5: 25,298,916 T3798I probably benign Het
Map1a T A 2: 121,305,255 M1946K probably damaging Het
Mfhas1 T A 8: 35,590,675 V768E probably benign Het
Mroh8 C A 2: 157,265,081 V223F possibly damaging Het
Mss51 A T 14: 20,487,573 V30E probably benign Het
Mtmr10 G A 7: 64,321,213 R392H probably benign Het
Mup3 T C 4: 62,085,961 N105S probably benign Het
Myh7b T C 2: 155,611,722 M22T probably benign Het
Olfr1034 T A 2: 86,047,311 Y276* probably null Het
Olfr170 T A 16: 19,606,272 Y132F probably damaging Het
Olfr97 T A 17: 37,232,155 I72F possibly damaging Het
Os9 A G 10: 127,120,991 I43T probably damaging Het
Pkhd1l1 T C 15: 44,483,838 L200P probably damaging Het
Ptpru C T 4: 131,820,887 V100M possibly damaging Het
Rnf6 G A 5: 146,210,721 R496C possibly damaging Het
Rsad1 C T 11: 94,542,639 R407Q probably damaging Het
Rspo3 T C 10: 29,504,637 D127G probably damaging Het
Sbf2 T A 7: 110,310,262 T1760S possibly damaging Het
Sh2d3c T A 2: 32,753,025 V588E probably damaging Het
Siglech A T 7: 55,769,162 T238S probably benign Het
Slc15a2 T A 16: 36,759,307 N328I probably damaging Het
Slc16a11 G T 11: 70,215,032 G94C probably damaging Het
Stub1 T C 17: 25,831,322 probably null Het
Tacc2 T A 7: 130,716,753 V40D probably damaging Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tsen54 A G 11: 115,815,064 E69G probably damaging Het
Tsks A G 7: 44,950,834 E150G probably damaging Het
Ubap2l A C 3: 90,017,220 V680G probably benign Het
Usp16 A T 16: 87,472,164 H315L probably benign Het
Vav2 A G 2: 27,296,121 probably null Het
Zfc3h1 T C 10: 115,420,810 F1562L possibly damaging Het
Zfp764 C A 7: 127,406,541 V22L probably benign Het
Other mutations in Adad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02347:Adad2 APN 8 119616669 missense probably damaging 1.00
IGL02385:Adad2 APN 8 119615034 splice site probably benign
R3410:Adad2 UTSW 8 119615969 missense probably benign
R4961:Adad2 UTSW 8 119615658 missense probably damaging 0.99
R5479:Adad2 UTSW 8 119614915 missense possibly damaging 0.93
R5521:Adad2 UTSW 8 119612789 missense probably benign 0.43
R5610:Adad2 UTSW 8 119614761 missense probably benign 0.00
R5624:Adad2 UTSW 8 119615105 splice site probably null
R6237:Adad2 UTSW 8 119615763 missense probably damaging 1.00
R6566:Adad2 UTSW 8 119614232 missense probably benign 0.13
R8069:Adad2 UTSW 8 119616007 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGTCGCAGCATCCATCACAGC -3'
(R):5'- GGCCAACGGGAAACCTGATCTTAC -3'

Sequencing Primer
(F):5'- AGCACCACAGTCTGTCATTGG -3'
(R):5'- cacagacacagagacacagg -3'
Posted On2013-07-11