Incidental Mutation 'R0619:Slc15a2'
ID58559
Institutional Source Beutler Lab
Gene Symbol Slc15a2
Ensembl Gene ENSMUSG00000022899
Gene Namesolute carrier family 15 (H+/peptide transporter), member 2
Synonyms8430408C16Rik, Pept2
MMRRC Submission 038808-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R0619 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location36750177-36784962 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36759307 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 328 (N328I)
Ref Sequence ENSEMBL: ENSMUSP00000132663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023616] [ENSMUST00000165380] [ENSMUST00000165531]
Predicted Effect probably damaging
Transcript: ENSMUST00000023616
AA Change: N359I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023616
Gene: ENSMUSG00000022899
AA Change: N359I

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:PTR2 122 500 1.7e-122 PFAM
Pfam:PTR2 593 686 2.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164770
Predicted Effect probably benign
Transcript: ENSMUST00000165380
SMART Domains Protein: ENSMUSP00000131395
Gene: ENSMUSG00000022899

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165531
AA Change: N328I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132663
Gene: ENSMUSG00000022899
AA Change: N328I

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:PTR2 99 469 2.4e-105 PFAM
PDB:2XUT|C 583 642 3e-10 PDB
transmembrane domain 655 677 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172382
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mammalian kidney expresses a proton-coupled peptide transporter that is responsible for the absorption of small peptides, as well as beta-lactam antibiotics and other peptide-like drugs, from the tubular filtrate. This transporter, SLC15A2, belongs to the same gene family as SLC15A1 (MIM 600544), the proton-coupled peptide transporter found in the small intestine (Liu et al, 1995 [PubMed 7756356]).[supplied by OMIM, Feb 2011]
PHENOTYPE: Homozygous mutant mice have impairments of dipeptide transportion, however, show no gross defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 G A 8: 119,613,000 D74N probably benign Het
Adgre4 T A 17: 55,820,679 V573D possibly damaging Het
Ak7 A G 12: 105,733,511 K230E probably damaging Het
Amdhd2 T C 17: 24,156,588 D375G possibly damaging Het
Anpep T C 7: 79,841,009 E253G probably benign Het
Bbs7 A G 3: 36,607,576 L158S probably benign Het
BC037034 A G 5: 138,263,826 probably benign Het
Bdp1 T C 13: 100,037,858 T2057A probably benign Het
C2 G T 17: 34,872,503 H61Q probably damaging Het
Ccdc18 A G 5: 108,180,416 K661E probably benign Het
Cdh23 C T 10: 60,433,777 V655I probably damaging Het
Cep78 T C 19: 15,978,862 T238A probably damaging Het
Ces2a T A 8: 104,736,110 N110K probably benign Het
Crat T C 2: 30,409,984 D128G probably benign Het
Dclre1a A T 19: 56,545,409 M233K probably benign Het
Dsg4 T C 18: 20,461,359 V515A probably benign Het
Fer1l6 T C 15: 58,662,935 probably null Het
Fryl T C 5: 73,068,731 D1863G probably benign Het
Fsip2 T A 2: 82,944,140 L57Q probably damaging Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Iqsec1 T C 6: 90,670,406 probably null Het
Kcnn3 A C 3: 89,652,030 T536P probably damaging Het
Kctd3 T C 1: 188,978,643 D441G probably damaging Het
Kifc3 G A 8: 95,102,665 T528M probably benign Het
Kmt2c G A 5: 25,298,916 T3798I probably benign Het
Map1a T A 2: 121,305,255 M1946K probably damaging Het
Mfhas1 T A 8: 35,590,675 V768E probably benign Het
Mroh8 C A 2: 157,265,081 V223F possibly damaging Het
Mss51 A T 14: 20,487,573 V30E probably benign Het
Mtmr10 G A 7: 64,321,213 R392H probably benign Het
Mup3 T C 4: 62,085,961 N105S probably benign Het
Myh7b T C 2: 155,611,722 M22T probably benign Het
Olfr1034 T A 2: 86,047,311 Y276* probably null Het
Olfr170 T A 16: 19,606,272 Y132F probably damaging Het
Olfr97 T A 17: 37,232,155 I72F possibly damaging Het
Os9 A G 10: 127,120,991 I43T probably damaging Het
Pkhd1l1 T C 15: 44,483,838 L200P probably damaging Het
Ptpru C T 4: 131,820,887 V100M possibly damaging Het
Rnf6 G A 5: 146,210,721 R496C possibly damaging Het
Rsad1 C T 11: 94,542,639 R407Q probably damaging Het
Rspo3 T C 10: 29,504,637 D127G probably damaging Het
Sbf2 T A 7: 110,310,262 T1760S possibly damaging Het
Sh2d3c T A 2: 32,753,025 V588E probably damaging Het
Siglech A T 7: 55,769,162 T238S probably benign Het
Slc16a11 G T 11: 70,215,032 G94C probably damaging Het
Stub1 T C 17: 25,831,322 probably null Het
Tacc2 T A 7: 130,716,753 V40D probably damaging Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tsen54 A G 11: 115,815,064 E69G probably damaging Het
Tsks A G 7: 44,950,834 E150G probably damaging Het
Ubap2l A C 3: 90,017,220 V680G probably benign Het
Usp16 A T 16: 87,472,164 H315L probably benign Het
Vav2 A G 2: 27,296,121 probably null Het
Zfc3h1 T C 10: 115,420,810 F1562L possibly damaging Het
Zfp764 C A 7: 127,406,541 V22L probably benign Het
Other mutations in Slc15a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Slc15a2 APN 16 36753775 missense probably benign 0.00
IGL00703:Slc15a2 APN 16 36757791 missense probably benign 0.00
IGL00937:Slc15a2 APN 16 36751880 nonsense probably null
IGL01511:Slc15a2 APN 16 36784726 missense probably damaging 0.99
IGL01739:Slc15a2 APN 16 36756230 missense probably benign
IGL02069:Slc15a2 APN 16 36759251 missense probably benign 0.02
IGL02076:Slc15a2 APN 16 36762381 missense probably damaging 1.00
IGL02254:Slc15a2 APN 16 36760087 missense possibly damaging 0.93
IGL02387:Slc15a2 APN 16 36751775 unclassified probably null
IGL02507:Slc15a2 APN 16 36781659 missense possibly damaging 0.87
IGL02829:Slc15a2 APN 16 36757193 missense possibly damaging 0.92
IGL03114:Slc15a2 APN 16 36751905 missense probably damaging 1.00
IGL03227:Slc15a2 APN 16 36756048 critical splice donor site probably null
PIT4581001:Slc15a2 UTSW 16 36772043 missense probably benign
R0058:Slc15a2 UTSW 16 36754547 missense probably benign 0.08
R0058:Slc15a2 UTSW 16 36754547 missense probably benign 0.08
R0083:Slc15a2 UTSW 16 36782283 missense probably damaging 1.00
R0099:Slc15a2 UTSW 16 36753036 missense probably damaging 1.00
R0104:Slc15a2 UTSW 16 36774635 missense possibly damaging 0.79
R0402:Slc15a2 UTSW 16 36775598 missense probably benign 0.00
R0963:Slc15a2 UTSW 16 36774573 missense probably damaging 1.00
R0972:Slc15a2 UTSW 16 36757139 missense probably benign 0.00
R1440:Slc15a2 UTSW 16 36784643 splice site probably benign
R1471:Slc15a2 UTSW 16 36753791 missense probably damaging 0.99
R1569:Slc15a2 UTSW 16 36756383 missense probably benign 0.00
R1616:Slc15a2 UTSW 16 36754481 missense probably benign
R2246:Slc15a2 UTSW 16 36762361 missense probably damaging 1.00
R2405:Slc15a2 UTSW 16 36751837 nonsense probably null
R3834:Slc15a2 UTSW 16 36772128 nonsense probably null
R3835:Slc15a2 UTSW 16 36772128 nonsense probably null
R3885:Slc15a2 UTSW 16 36782304 missense probably damaging 1.00
R3887:Slc15a2 UTSW 16 36782304 missense probably damaging 1.00
R3888:Slc15a2 UTSW 16 36782304 missense probably damaging 1.00
R3889:Slc15a2 UTSW 16 36782304 missense probably damaging 1.00
R4105:Slc15a2 UTSW 16 36782393 intron probably benign
R4108:Slc15a2 UTSW 16 36782393 intron probably benign
R4254:Slc15a2 UTSW 16 36754490 missense probably benign 0.04
R4352:Slc15a2 UTSW 16 36772028 missense probably benign 0.08
R4684:Slc15a2 UTSW 16 36757849 missense probably damaging 1.00
R4747:Slc15a2 UTSW 16 36772136 missense probably damaging 0.98
R4774:Slc15a2 UTSW 16 36781695 nonsense probably null
R5151:Slc15a2 UTSW 16 36752297 missense probably damaging 1.00
R5503:Slc15a2 UTSW 16 36762385 missense probably damaging 1.00
R5649:Slc15a2 UTSW 16 36772110 nonsense probably null
R6003:Slc15a2 UTSW 16 36754548 missense probably benign 0.00
R6261:Slc15a2 UTSW 16 36761611 missense probably benign 0.25
R6329:Slc15a2 UTSW 16 36751782 missense possibly damaging 0.94
R6409:Slc15a2 UTSW 16 36761870 missense probably benign 0.00
R6523:Slc15a2 UTSW 16 36752321 missense probably benign 0.17
R7125:Slc15a2 UTSW 16 36782298 missense probably damaging 1.00
R7208:Slc15a2 UTSW 16 36756281 missense probably benign 0.02
R7234:Slc15a2 UTSW 16 36757811 missense probably benign 0.05
R7374:Slc15a2 UTSW 16 36751845 missense probably benign 0.01
R7545:Slc15a2 UTSW 16 36775602 missense probably damaging 1.00
R7559:Slc15a2 UTSW 16 36751897 missense probably benign
R7611:Slc15a2 UTSW 16 36756311 missense probably benign 0.18
R7787:Slc15a2 UTSW 16 36751866 missense probably benign 0.02
R7825:Slc15a2 UTSW 16 36753034 missense possibly damaging 0.94
T0722:Slc15a2 UTSW 16 36772445 missense probably benign
V8831:Slc15a2 UTSW 16 36772445 missense probably benign
X0066:Slc15a2 UTSW 16 36753789 nonsense probably null
Z1088:Slc15a2 UTSW 16 36772445 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCAAGCTGGGCAAACTGAGTATG -3'
(R):5'- CAGCTAGGCACTTGTCTGACACAC -3'

Sequencing Primer
(F):5'- CTGGGCAAACTGAGTATGTAAAC -3'
(R):5'- AGAGCATGAGCTCATTCAGG -3'
Posted On2013-07-11