Incidental Mutation 'R7563:Olfr1023'
ID585236
Institutional Source Beutler Lab
Gene Symbol Olfr1023
Ensembl Gene ENSMUSG00000050128
Gene Nameolfactory receptor 1023
SynonymsMOR196-3, GA_x6K02T2Q125-47363965-47364900
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R7563 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location85885640-85891213 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85887138 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 113 (Y113N)
Ref Sequence ENSEMBL: ENSMUSP00000149138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056408] [ENSMUST00000213441]
Predicted Effect probably damaging
Transcript: ENSMUST00000056408
AA Change: Y113N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000059849
Gene: ENSMUSG00000050128
AA Change: Y113N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 304 2.6e-7 PFAM
Pfam:7tm_1 41 290 2.4e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213441
AA Change: Y113N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A T 17: 23,717,328 F8L probably benign Het
Aadacl3 A G 4: 144,457,894 I98T probably damaging Het
Ahnak T C 19: 9,011,165 I3271T probably damaging Het
Aox1 G A 1: 58,047,145 V70I probably benign Het
Ap1g2 A G 14: 55,099,749 S710P probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cacna1e T C 1: 154,471,416 K1064E probably benign Het
Capn11 T A 17: 45,633,965 I459F probably damaging Het
Ccnc A G 4: 21,732,220 I48V probably damaging Het
Ces1d T A 8: 93,178,039 I358F probably benign Het
Clgn A T 8: 83,420,556 N379I probably damaging Het
Cym T C 3: 107,214,232 Y248C probably damaging Het
Epha8 T C 4: 136,938,789 D352G possibly damaging Het
Eya2 T C 2: 165,716,130 probably null Het
Fbxl5 C T 5: 43,821,549 V20I probably benign Het
Fscb T C 12: 64,473,285 E469G possibly damaging Het
Glt8d2 A T 10: 82,660,825 probably null Het
Gm13088 A T 4: 143,654,105 Y449* probably null Het
Helt T C 8: 46,293,593 probably benign Het
Igkv8-27 G T 6: 70,171,903 T89K probably benign Het
Ipo5 T A 14: 120,946,155 H1048Q probably benign Het
Kalrn T C 16: 34,392,094 D28G probably damaging Het
Kcnh4 G A 11: 100,741,854 P936S probably benign Het
Klrd1 A G 6: 129,593,738 I37M possibly damaging Het
Kmt2e T C 5: 23,500,273 V1267A probably damaging Het
Lrrc29 A G 8: 105,315,756 C147R probably benign Het
March1 A T 8: 66,468,313 Q214L probably damaging Het
Mlip G T 9: 77,112,997 H52N probably damaging Het
Oas1e T C 5: 120,788,956 R229G probably benign Het
Ogfr T A 2: 180,592,507 probably null Het
Olfr1279 T C 2: 111,306,789 F195L probably benign Het
Pde4d T C 13: 109,951,007 I636T probably benign Het
Pex5l C T 3: 32,954,476 V426I probably damaging Het
Pmfbp1 A G 8: 109,525,374 K384E possibly damaging Het
Prl6a1 T G 13: 27,314,238 probably null Het
Prss23 A T 7: 89,509,830 W344R probably damaging Het
Ptar1 T A 19: 23,720,316 D397E probably benign Het
Qrsl1 G A 10: 43,876,517 R437C probably damaging Het
Rab6a G T 7: 100,608,197 probably benign Het
Samd14 C A 11: 95,021,413 S205R probably benign Het
Sel1l3 T C 5: 53,185,984 Y322C probably damaging Het
Slc30a5 A T 13: 100,803,972 L669I probably benign Het
Ssc4d A G 5: 135,963,033 L419P probably damaging Het
Tbc1d2b A T 9: 90,219,010 Y642* probably null Het
Tbc1d2b A C 9: 90,226,248 F417V probably benign Het
Top2a T C 11: 99,016,179 D212G probably damaging Het
Trim39 A T 17: 36,260,915 V317E probably damaging Het
Uncx G A 5: 139,544,506 R113H probably damaging Het
Usp4 A G 9: 108,379,344 S655G probably benign Het
Vmn2r114 C T 17: 23,291,026 V827I probably benign Het
Vmn2r28 T A 7: 5,488,201 N349I probably benign Het
Vmn2r3 A G 3: 64,275,349 W310R possibly damaging Het
Xirp2 T C 2: 67,509,901 W829R probably damaging Het
Zfp574 C A 7: 25,081,352 H600N possibly damaging Het
Other mutations in Olfr1023
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01536:Olfr1023 APN 2 85887600 missense probably damaging 1.00
IGL01622:Olfr1023 APN 2 85886962 missense probably benign 0.01
IGL01623:Olfr1023 APN 2 85886962 missense probably benign 0.01
IGL01977:Olfr1023 APN 2 85887367 missense probably damaging 1.00
IGL02057:Olfr1023 APN 2 85886931 missense probably benign 0.00
IGL02555:Olfr1023 APN 2 85887398 missense probably benign 0.34
IGL03133:Olfr1023 APN 2 85887134 missense probably damaging 1.00
IGL03180:Olfr1023 APN 2 85887396 missense probably benign 0.00
R0415:Olfr1023 UTSW 2 85887438 missense possibly damaging 0.94
R1476:Olfr1023 UTSW 2 85887248 nonsense probably null
R1544:Olfr1023 UTSW 2 85887271 missense probably damaging 1.00
R2058:Olfr1023 UTSW 2 85886952 missense possibly damaging 0.48
R4096:Olfr1023 UTSW 2 85887423 missense probably damaging 0.98
R5055:Olfr1023 UTSW 2 85887241 missense probably benign 0.12
R5703:Olfr1023 UTSW 2 85887439 missense probably benign 0.06
R6297:Olfr1023 UTSW 2 85886815 missense probably benign 0.35
R7041:Olfr1023 UTSW 2 85887621 missense probably benign 0.01
R7070:Olfr1023 UTSW 2 85887690 missense probably benign 0.13
R7777:Olfr1023 UTSW 2 85887607 missense possibly damaging 0.83
R7913:Olfr1023 UTSW 2 85887730 missense probably damaging 0.96
R7994:Olfr1023 UTSW 2 85887730 missense probably damaging 0.96
S24628:Olfr1023 UTSW 2 85887438 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACACTGGCAGGAAACTTGTTC -3'
(R):5'- TTCATGGGAGCCACAGAAAG -3'

Sequencing Primer
(F):5'- GTGCTGATCAGGACCAATTCC -3'
(R):5'- GCCACAGAAAGACAGGTGG -3'
Posted On2019-10-17