Incidental Mutation 'R7569:Olfr993'
ID585620
Institutional Source Beutler Lab
Gene Symbol Olfr993
Ensembl Gene ENSMUSG00000075220
Gene Nameolfactory receptor 993
SynonymsGA_x6K02T2Q125-46891524-46890580, MOR203-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R7569 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location85413933-85414877 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85414135 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 248 (V248A)
Ref Sequence ENSEMBL: ENSMUSP00000097510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099926] [ENSMUST00000213749] [ENSMUST00000214895] [ENSMUST00000215617]
Predicted Effect probably damaging
Transcript: ENSMUST00000099926
AA Change: V248A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097510
Gene: ENSMUSG00000075220
AA Change: V248A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 303 1.3e-7 PFAM
Pfam:7tm_1 41 290 2.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213749
Predicted Effect probably benign
Transcript: ENSMUST00000214895
Predicted Effect probably benign
Transcript: ENSMUST00000215617
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
9330182O14Rik A T 15: 40,144,948 T73S unknown Het
Acvrl1 A G 15: 101,135,755 Q106R probably benign Het
Adgb A T 10: 10,431,252 D329E probably benign Het
Ankrd12 A T 17: 65,982,905 D1844E probably damaging Het
Ankub1 G A 3: 57,665,618 R228* probably null Het
Apol6 A C 15: 77,050,698 probably benign Het
Ascc2 G A 11: 4,679,506 V618M probably damaging Het
Asic3 A G 5: 24,414,048 T113A probably benign Het
BC034090 T A 1: 155,217,405 H769L probably benign Het
Bcl11a G T 11: 24,085,458 E65* probably null Het
Birc6 G T 17: 74,598,082 R1290L possibly damaging Het
C6 A G 15: 4,789,581 E465G probably benign Het
Cav2 T A 6: 17,282,079 I112N probably damaging Het
Cep131 G A 11: 120,066,713 A848V probably damaging Het
Col8a1 T A 16: 57,627,192 I652F unknown Het
Cul4a A G 8: 13,123,493 N180S probably benign Het
Dhx38 A G 8: 109,560,695 S214P probably damaging Het
Dmxl2 A G 9: 54,415,987 V1197A possibly damaging Het
Dusp27 T C 1: 166,108,035 D198G probably damaging Het
Dynlt1f A G 17: 6,655,782 S7P not run Het
Epha1 T A 6: 42,365,422 T331S possibly damaging Het
Gm10436 A T 12: 88,176,315 Y373N probably benign Het
Gm49333 T A 16: 20,642,487 Y641* probably null Het
Hus1b A G 13: 30,946,864 Y271H probably damaging Het
Kmt2b A G 7: 30,569,553 V2610A possibly damaging Het
Lama2 A G 10: 27,265,050 L651P probably damaging Het
Lgr5 T C 10: 115,462,756 Y361C probably damaging Het
Map1s T C 8: 70,913,498 V349A probably benign Het
Map3k6 A G 4: 133,250,077 R912G probably benign Het
Marc2 A T 1: 184,841,425 F92Y possibly damaging Het
Nampt T A 12: 32,850,434 H459Q probably benign Het
Nlrp1a T C 11: 71,109,043 M817V probably benign Het
Npsr1 A G 9: 24,313,730 R345G probably benign Het
Nuak2 G A 1: 132,316,281 A18T possibly damaging Het
Olfr1428 T C 19: 12,109,021 D175G possibly damaging Het
Ppp4r3b T C 11: 29,188,540 F296S possibly damaging Het
Pycr2 T C 1: 180,904,518 F19L probably benign Het
Robo2 T A 16: 74,035,115 T226S possibly damaging Het
Rock1 A T 18: 10,140,194 N132K probably damaging Het
Rp1 A T 1: 4,284,840 L379Q unknown Het
Sema6d A G 2: 124,657,972 I323V possibly damaging Het
Slc12a4 A G 8: 105,945,847 I814T probably damaging Het
Slc18a2 G A 19: 59,284,152 G352R probably damaging Het
Slc39a14 T C 14: 70,309,827 T357A possibly damaging Het
Smarcad1 T A 6: 65,052,711 D94E probably benign Het
Sorcs2 A G 5: 36,025,876 Y1018H probably benign Het
Srebf1 G T 11: 60,200,121 T1069K possibly damaging Het
St3gal3 A G 4: 117,964,356 V123A probably benign Het
Stradb A G 1: 58,991,151 Y188C unknown Het
Sult2a2 T C 7: 13,779,505 F186L probably benign Het
Syne2 A G 12: 75,927,390 T1120A probably benign Het
Taok1 A T 11: 77,555,614 S430T probably benign Het
Tmem62 A T 2: 121,006,930 I573L probably benign Het
Trav9-1 T C 14: 53,488,124 S7P probably benign Het
U2af1l4 A T 7: 30,563,557 I24F probably damaging Het
Usp33 T A 3: 152,391,665 I840N probably damaging Het
Vmn2r74 A C 7: 85,952,336 I698S probably damaging Het
Zfp352 C T 4: 90,223,659 P12L possibly damaging Het
Zfp507 T A 7: 35,794,544 E358V probably damaging Het
Other mutations in Olfr993
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02428:Olfr993 APN 2 85414193 missense probably benign 0.05
IGL03209:Olfr993 APN 2 85414379 missense probably benign 0.05
BB001:Olfr993 UTSW 2 85414219 missense probably benign 0.06
BB011:Olfr993 UTSW 2 85414219 missense probably benign 0.06
R0591:Olfr993 UTSW 2 85414690 missense possibly damaging 0.95
R1437:Olfr993 UTSW 2 85414874 missense probably benign 0.01
R1836:Olfr993 UTSW 2 85414405 missense probably benign 0.36
R2084:Olfr993 UTSW 2 85414615 missense probably benign 0.01
R2902:Olfr993 UTSW 2 85414052 missense possibly damaging 0.79
R2910:Olfr993 UTSW 2 85414351 missense probably damaging 1.00
R3961:Olfr993 UTSW 2 85414872 missense possibly damaging 0.69
R4542:Olfr993 UTSW 2 85413943 missense probably benign
R4635:Olfr993 UTSW 2 85414864 missense probably damaging 1.00
R5464:Olfr993 UTSW 2 85414713 frame shift probably null
R5980:Olfr993 UTSW 2 85414165 missense probably damaging 1.00
R6139:Olfr993 UTSW 2 85414346 missense probably damaging 1.00
R6356:Olfr993 UTSW 2 85414687 missense probably damaging 1.00
R6619:Olfr993 UTSW 2 85414081 missense probably benign 0.05
R6672:Olfr993 UTSW 2 85414604 missense possibly damaging 0.87
R7326:Olfr993 UTSW 2 85414444 missense probably damaging 0.99
R7328:Olfr993 UTSW 2 85414324 missense probably benign 0.32
R7924:Olfr993 UTSW 2 85414219 missense probably benign 0.06
Z1176:Olfr993 UTSW 2 85414663 missense probably damaging 1.00
Z1176:Olfr993 UTSW 2 85414685 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GTCACCATTTAAGAACTCACGACTTC -3'
(R):5'- TCCTGCTCCAACATTGAGAC -3'

Sequencing Primer
(F):5'- CATGGGAATCACAATGCC -3'
(R):5'- TGCTCCAACATTGAGACCAATATC -3'
Posted On2019-10-17