Incidental Mutation 'R3961:Olfr993'
ID312075
Institutional Source Beutler Lab
Gene Symbol Olfr993
Ensembl Gene ENSMUSG00000075220
Gene Nameolfactory receptor 993
SynonymsGA_x6K02T2Q125-46891524-46890580, MOR203-2
MMRRC Submission 040836-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R3961 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85413933-85414877 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85414872 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 2 (I2M)
Ref Sequence ENSEMBL: ENSMUSP00000097510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099926]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099926
AA Change: I2M

PolyPhen 2 Score 0.689 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097510
Gene: ENSMUSG00000075220
AA Change: I2M

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 303 1.3e-7 PFAM
Pfam:7tm_1 41 290 2.2e-21 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
Bicral T C 17: 46,824,825 I486M probably damaging Het
Btbd1 C A 7: 81,818,335 E146* probably null Het
Cdcp1 T C 9: 123,182,381 T344A possibly damaging Het
Cenpm A T 15: 82,234,373 L180Q possibly damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Dazl A G 17: 50,288,133 V91A probably damaging Het
Dsc2 C T 18: 20,051,227 V35I probably damaging Het
Fras1 T C 5: 96,677,385 probably null Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mme T A 3: 63,345,192 M419K probably damaging Het
Ncan G A 8: 70,110,300 T436M probably benign Het
Nphp3 G T 9: 104,003,042 E88* probably null Het
Pdcl T C 2: 37,352,187 M184V probably benign Het
Polr3b T C 10: 84,684,302 M694T possibly damaging Het
Pramef8 T A 4: 143,419,318 N452K probably benign Het
Prkdc T G 16: 15,829,611 probably null Het
Prss35 A G 9: 86,755,749 M191V probably benign Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Taf7 A G 18: 37,643,121 V131A probably benign Het
Tesk1 A G 4: 43,445,133 probably null Het
Tmem131 C T 1: 36,818,950 D741N probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tpte A G 8: 22,359,415 S553G probably damaging Het
Trpv3 A T 11: 73,287,420 K438* probably null Het
Vmn2r107 G A 17: 20,375,455 G757R probably damaging Het
Other mutations in Olfr993
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02428:Olfr993 APN 2 85414193 missense probably benign 0.05
IGL03209:Olfr993 APN 2 85414379 missense probably benign 0.05
R0591:Olfr993 UTSW 2 85414690 missense possibly damaging 0.95
R1437:Olfr993 UTSW 2 85414874 missense probably benign 0.01
R1836:Olfr993 UTSW 2 85414405 missense probably benign 0.36
R2084:Olfr993 UTSW 2 85414615 missense probably benign 0.01
R2902:Olfr993 UTSW 2 85414052 missense possibly damaging 0.79
R2910:Olfr993 UTSW 2 85414351 missense probably damaging 1.00
R4542:Olfr993 UTSW 2 85413943 missense probably benign
R4635:Olfr993 UTSW 2 85414864 missense probably damaging 1.00
R5464:Olfr993 UTSW 2 85414713 frame shift probably null
R5980:Olfr993 UTSW 2 85414165 missense probably damaging 1.00
R6139:Olfr993 UTSW 2 85414346 missense probably damaging 1.00
R6356:Olfr993 UTSW 2 85414687 missense probably damaging 1.00
R6619:Olfr993 UTSW 2 85414081 missense probably benign 0.05
R6672:Olfr993 UTSW 2 85414604 missense possibly damaging 0.87
R7326:Olfr993 UTSW 2 85414444 missense probably damaging 0.99
R7328:Olfr993 UTSW 2 85414324 missense probably benign 0.32
R7569:Olfr993 UTSW 2 85414135 missense probably damaging 1.00
Z1176:Olfr993 UTSW 2 85414663 missense probably damaging 1.00
Z1176:Olfr993 UTSW 2 85414685 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GGGTCTGAAGTCTGGAGTCA -3'
(R):5'- GTGGTCTTTTGAGTATAGAGCACAT -3'

Sequencing Primer
(F):5'- CAGTGTGGATTAGAAGAATCATCCC -3'
(R):5'- GCACATTATCTGTAAATAGGGATA -3'
Posted On2015-04-29