Incidental Mutation 'R7572:Ankfn1'
ID586094
Institutional Source Beutler Lab
Gene Symbol Ankfn1
Ensembl Gene ENSMUSG00000047773
Gene Nameankyrin-repeat and fibronectin type III domain containing 1
SynonymsLOC382543
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R7572 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location89390223-89777653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89421271 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 683 (N683D)
Ref Sequence ENSEMBL: ENSMUSP00000132133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050983] [ENSMUST00000128717] [ENSMUST00000169201]
Predicted Effect probably benign
Transcript: ENSMUST00000050983
SMART Domains Protein: ENSMUSP00000049776
Gene: ENSMUSG00000047773

DomainStartEndE-ValueType
low complexity region 207 220 N/A INTRINSIC
low complexity region 377 394 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000121290
Gene: ENSMUSG00000047773
AA Change: N703D

DomainStartEndE-ValueType
ANK 136 167 2.47e2 SMART
ANK 173 204 1.46e-2 SMART
coiled coil region 205 236 N/A INTRINSIC
FN3 271 356 1.66e-7 SMART
low complexity region 586 597 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169201
AA Change: N683D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132133
Gene: ENSMUSG00000047773
AA Change: N683D

DomainStartEndE-ValueType
ANK 116 147 2.47e2 SMART
ANK 153 184 1.46e-2 SMART
coiled coil region 185 216 N/A INTRINSIC
FN3 251 336 1.66e-7 SMART
low complexity region 566 577 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 95% (56/59)
MGI Phenotype PHENOTYPE: Mutant mice exhibit a variable and subtle head nodding phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T A 14: 59,142,679 T57S possibly damaging Het
Adamts1 A G 16: 85,797,741 Y670H possibly damaging Het
Akr1b7 A T 6: 34,419,408 I185F probably damaging Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Chrna5 T A 9: 55,006,465 W432R probably damaging Het
Chrng T A 1: 87,209,114 L235Q probably damaging Het
Ciao1 A T 2: 127,246,711 C97* probably null Het
Cpt2 G T 4: 107,907,548 H340N probably damaging Het
Dmtn A T 14: 70,605,337 M328K possibly damaging Het
Dusp10 T A 1: 184,074,309 V413E probably damaging Het
Epha3 A T 16: 63,611,080 L487* probably null Het
Esco2 A G 14: 65,831,192 V223A probably damaging Het
Fryl A T 5: 73,088,396 D1139E possibly damaging Het
Gemin4 A G 11: 76,213,582 S118P probably damaging Het
Gm16486 T C 8: 70,709,426 S423P probably benign Het
Gm3604 A G 13: 62,370,246 I79T probably damaging Het
Gpatch3 T C 4: 133,574,806 V16A probably benign Het
Hcn4 A G 9: 58,823,780 N90S unknown Het
Hr C T 14: 70,561,853 H593Y possibly damaging Het
Igkv4-50 A G 6: 69,700,967 V51A probably damaging Het
Insr C A 8: 3,173,602 V844F probably benign Het
Kcns2 T C 15: 34,839,172 F227S possibly damaging Het
Map4k1 A G 7: 28,987,138 I162V probably benign Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Neurog2 A G 3: 127,633,901 E58G probably damaging Het
Olfr1269 T C 2: 90,118,743 Y285C probably damaging Het
Olfr193 T A 16: 59,110,430 Y60F probably damaging Het
Olfr868 T G 9: 20,100,858 L33W probably damaging Het
Orc4 A T 2: 48,910,236 M300K probably benign Het
Plch1 T C 3: 63,740,684 D422G possibly damaging Het
Prox1 T C 1: 190,123,386 E683G probably benign Het
Pxdn A G 12: 30,006,705 D1305G probably damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rex2 T G 4: 147,057,872 I272M probably damaging Het
Rpa2 T C 4: 132,768,703 S12P possibly damaging Het
Samd15 C A 12: 87,201,576 P345Q probably damaging Het
Sema5a T A 15: 32,673,428 I804N probably damaging Het
Sgsm3 G A 15: 81,007,466 R165H possibly damaging Het
Slc22a30 T G 19: 8,335,708 M467L unknown Het
Slc2a5 T C 4: 150,142,185 I368T probably benign Het
Slc8a1 A T 17: 81,441,771 probably null Het
Snap91 T C 9: 86,806,494 T331A possibly damaging Het
Soat2 G T 15: 102,154,021 probably null Het
Sptbn4 C A 7: 27,372,272 R1589L probably damaging Het
Stk38l A G 6: 146,775,654 Y443C probably damaging Het
Sult5a1 T C 8: 123,145,378 I242V probably benign Het
Susd3 T C 13: 49,231,162 R262G probably benign Het
Syt9 A G 7: 107,436,577 D267G probably damaging Het
Tbce A G 13: 14,010,587 V172A probably benign Het
Tcstv3 A T 13: 120,317,571 D2V possibly damaging Het
Tmod1 T A 4: 46,083,593 S7R possibly damaging Het
Ubqln4 C T 3: 88,555,424 probably benign Het
Ucp2 T C 7: 100,497,307 probably null Het
Usp30 G A 5: 114,120,247 S306N probably benign Het
Usp5 A T 6: 124,818,007 I660N probably damaging Het
Vmn1r43 A G 6: 89,869,565 V313A possibly damaging Het
Wdr49 T C 3: 75,358,437 H234R possibly damaging Het
Wdr70 T C 15: 8,035,846 D245G possibly damaging Het
Zc3h6 A G 2: 129,017,252 K1068E probably benign Het
Zfp141 T C 7: 42,475,432 K539E probably benign Het
Zfp758 T A 17: 22,374,891 H119Q possibly damaging Het
Other mutations in Ankfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Ankfn1 APN 11 89391639 missense probably benign 0.01
IGL02519:Ankfn1 APN 11 89405678 missense probably benign
IGL02695:Ankfn1 APN 11 89391819 missense probably damaging 0.99
IGL02818:Ankfn1 APN 11 89538466 missense probably benign
IGL02821:Ankfn1 APN 11 89391616 missense probably benign 0.00
IGL03166:Ankfn1 APN 11 89538438 missense probably benign 0.19
R0056:Ankfn1 UTSW 11 89391676 missense possibly damaging 0.71
R0070:Ankfn1 UTSW 11 89392302 missense probably damaging 0.99
R0070:Ankfn1 UTSW 11 89392302 missense probably damaging 0.99
R0200:Ankfn1 UTSW 11 89441966 missense possibly damaging 0.67
R0427:Ankfn1 UTSW 11 89405597 missense probably damaging 0.99
R0755:Ankfn1 UTSW 11 89392087 missense probably benign
R1240:Ankfn1 UTSW 11 89392134 missense probably damaging 0.99
R1534:Ankfn1 UTSW 11 89523151 missense probably damaging 1.00
R1539:Ankfn1 UTSW 11 89441391 missense probably damaging 1.00
R1548:Ankfn1 UTSW 11 89526541 missense probably damaging 0.98
R1595:Ankfn1 UTSW 11 89422767 critical splice donor site probably null
R1776:Ankfn1 UTSW 11 89526474 missense possibly damaging 0.74
R1835:Ankfn1 UTSW 11 89447618 missense probably benign 0.25
R2012:Ankfn1 UTSW 11 89405597 missense probably damaging 0.99
R2037:Ankfn1 UTSW 11 89456120 missense probably benign 0.13
R2175:Ankfn1 UTSW 11 89526537 missense probably damaging 1.00
R2876:Ankfn1 UTSW 11 89391636 missense possibly damaging 0.90
R3778:Ankfn1 UTSW 11 89441394 missense probably damaging 1.00
R4720:Ankfn1 UTSW 11 89441426 missense possibly damaging 0.50
R5001:Ankfn1 UTSW 11 89441442 missense possibly damaging 0.85
R5318:Ankfn1 UTSW 11 89391928 missense probably damaging 0.96
R5412:Ankfn1 UTSW 11 89505181 missense probably benign 0.17
R5434:Ankfn1 UTSW 11 89453187 missense probably damaging 1.00
R5458:Ankfn1 UTSW 11 89434810 missense probably benign 0.00
R5710:Ankfn1 UTSW 11 89503925 missense probably benign 0.02
R6457:Ankfn1 UTSW 11 89391844 missense probably benign 0.00
R7026:Ankfn1 UTSW 11 89639577 makesense probably null
R7356:Ankfn1 UTSW 11 89434773 missense probably damaging 0.97
R7499:Ankfn1 UTSW 11 89391750 missense probably benign 0.12
R7577:Ankfn1 UTSW 11 89503971 missense probably benign 0.04
R7582:Ankfn1 UTSW 11 89526619 missense probably benign 0.04
R7820:Ankfn1 UTSW 11 89421130 missense probably damaging 0.99
R7908:Ankfn1 UTSW 11 89405534 missense probably damaging 1.00
R7992:Ankfn1 UTSW 11 89523033 missense probably benign 0.02
R8137:Ankfn1 UTSW 11 89453177 missense probably benign 0.00
X0012:Ankfn1 UTSW 11 89425544 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTACTATACCGAGTTCAAACATC -3'
(R):5'- GCCCCAGAATGCAATCATTTTC -3'

Sequencing Primer
(F):5'- TACCGAGTTCAAACATCTGAAGAG -3'
(R):5'- CAGAGTTTATGTGGAACATTACTGCC -3'
Posted On2019-10-24