Incidental Mutation 'R7572:Sptbn4'
ID586081
Institutional Source Beutler Lab
Gene Symbol Sptbn4
Ensembl Gene ENSMUSG00000011751
Gene Namespectrin beta, non-erythrocytic 4
SynonymsROSA62, 1700022P15Rik, dyn, neuroaxonal dystrophy, 5830426A08Rik, nmf261, SpbIV, Spnb4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.488) question?
Stock #R7572 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location27356383-27447686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 27372272 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 1589 (R1589L)
Ref Sequence ENSEMBL: ENSMUSP00000011895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011895] [ENSMUST00000108362] [ENSMUST00000108363] [ENSMUST00000108364] [ENSMUST00000172269]
Predicted Effect probably damaging
Transcript: ENSMUST00000011895
AA Change: R1589L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751
AA Change: R1589L

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.4e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 642 7.62e-19 SMART
SPEC 648 766 1.31e-8 SMART
SPEC 772 874 2.94e-11 SMART
SPEC 880 980 1.49e-21 SMART
SPEC 986 1081 1.65e0 SMART
SPEC 1087 1192 2.82e-13 SMART
SPEC 1198 1298 6.59e-14 SMART
SPEC 1304 1403 4.08e-19 SMART
SPEC 1409 1508 5.92e-7 SMART
SPEC 1514 1614 2.45e-22 SMART
SPEC 1620 1720 1.45e-24 SMART
SPEC 1726 1827 1.86e-22 SMART
SPEC 1833 1935 9.54e-11 SMART
SPEC 1941 2041 1.35e-19 SMART
SPEC 2047 2297 1.06e-8 SMART
low complexity region 2358 2412 N/A INTRINSIC
PH 2416 2526 1.54e-14 SMART
low complexity region 2549 2560 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108362
AA Change: R269L

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103999
Gene: ENSMUSG00000011751
AA Change: R269L

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108363
AA Change: R269L

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104000
Gene: ENSMUSG00000011751
AA Change: R269L

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108364
AA Change: R269L

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104001
Gene: ENSMUSG00000011751
AA Change: R269L

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172269
AA Change: R1584L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751
AA Change: R1584L

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.9e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 637 3.45e-17 SMART
SPEC 643 761 1.31e-8 SMART
SPEC 767 869 2.94e-11 SMART
SPEC 875 975 1.49e-21 SMART
SPEC 981 1076 1.65e0 SMART
SPEC 1082 1187 2.82e-13 SMART
SPEC 1193 1293 6.59e-14 SMART
SPEC 1299 1398 4.08e-19 SMART
SPEC 1404 1503 5.92e-7 SMART
SPEC 1509 1609 2.45e-22 SMART
SPEC 1615 1715 1.45e-24 SMART
SPEC 1721 1822 1.86e-22 SMART
SPEC 1828 1930 9.54e-11 SMART
SPEC 1936 2036 1.35e-19 SMART
SPEC 2042 2292 1.06e-8 SMART
low complexity region 2352 2406 N/A INTRINSIC
PH 2410 2520 1.54e-14 SMART
low complexity region 2543 2554 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 95% (56/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit tremors, progressive ataxia with hind limb paralysis, central deafness, reduced body weight, and shortened lifespan. Males are sterile, but females may breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T A 14: 59,142,679 T57S possibly damaging Het
Adamts1 A G 16: 85,797,741 Y670H possibly damaging Het
Akr1b7 A T 6: 34,419,408 I185F probably damaging Het
Ankfn1 T C 11: 89,421,271 N683D probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Chrna5 T A 9: 55,006,465 W432R probably damaging Het
Chrng T A 1: 87,209,114 L235Q probably damaging Het
Ciao1 A T 2: 127,246,711 C97* probably null Het
Cpt2 G T 4: 107,907,548 H340N probably damaging Het
Dmtn A T 14: 70,605,337 M328K possibly damaging Het
Dusp10 T A 1: 184,074,309 V413E probably damaging Het
Epha3 A T 16: 63,611,080 L487* probably null Het
Esco2 A G 14: 65,831,192 V223A probably damaging Het
Fryl A T 5: 73,088,396 D1139E possibly damaging Het
Gemin4 A G 11: 76,213,582 S118P probably damaging Het
Gm16486 T C 8: 70,709,426 S423P probably benign Het
Gm3604 A G 13: 62,370,246 I79T probably damaging Het
Gpatch3 T C 4: 133,574,806 V16A probably benign Het
Hcn4 A G 9: 58,823,780 N90S unknown Het
Hr C T 14: 70,561,853 H593Y possibly damaging Het
Igkv4-50 A G 6: 69,700,967 V51A probably damaging Het
Insr C A 8: 3,173,602 V844F probably benign Het
Kcns2 T C 15: 34,839,172 F227S possibly damaging Het
Map4k1 A G 7: 28,987,138 I162V probably benign Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Neurog2 A G 3: 127,633,901 E58G probably damaging Het
Olfr1269 T C 2: 90,118,743 Y285C probably damaging Het
Olfr193 T A 16: 59,110,430 Y60F probably damaging Het
Olfr868 T G 9: 20,100,858 L33W probably damaging Het
Orc4 A T 2: 48,910,236 M300K probably benign Het
Plch1 T C 3: 63,740,684 D422G possibly damaging Het
Prox1 T C 1: 190,123,386 E683G probably benign Het
Pxdn A G 12: 30,006,705 D1305G probably damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rex2 T G 4: 147,057,872 I272M probably damaging Het
Rpa2 T C 4: 132,768,703 S12P possibly damaging Het
Samd15 C A 12: 87,201,576 P345Q probably damaging Het
Sema5a T A 15: 32,673,428 I804N probably damaging Het
Sgsm3 G A 15: 81,007,466 R165H possibly damaging Het
Slc22a30 T G 19: 8,335,708 M467L unknown Het
Slc2a5 T C 4: 150,142,185 I368T probably benign Het
Slc8a1 A T 17: 81,441,771 probably null Het
Snap91 T C 9: 86,806,494 T331A possibly damaging Het
Soat2 G T 15: 102,154,021 probably null Het
Stk38l A G 6: 146,775,654 Y443C probably damaging Het
Sult5a1 T C 8: 123,145,378 I242V probably benign Het
Susd3 T C 13: 49,231,162 R262G probably benign Het
Syt9 A G 7: 107,436,577 D267G probably damaging Het
Tbce A G 13: 14,010,587 V172A probably benign Het
Tcstv3 A T 13: 120,317,571 D2V possibly damaging Het
Tmod1 T A 4: 46,083,593 S7R possibly damaging Het
Ubqln4 C T 3: 88,555,424 probably benign Het
Ucp2 T C 7: 100,497,307 probably null Het
Usp30 G A 5: 114,120,247 S306N probably benign Het
Usp5 A T 6: 124,818,007 I660N probably damaging Het
Vmn1r43 A G 6: 89,869,565 V313A possibly damaging Het
Wdr49 T C 3: 75,358,437 H234R possibly damaging Het
Wdr70 T C 15: 8,035,846 D245G possibly damaging Het
Zc3h6 A G 2: 129,017,252 K1068E probably benign Het
Zfp141 T C 7: 42,475,432 K539E probably benign Het
Zfp758 T A 17: 22,374,891 H119Q possibly damaging Het
Other mutations in Sptbn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sptbn4 APN 7 27369434 missense probably damaging 1.00
IGL00468:Sptbn4 APN 7 27417965 missense probably damaging 1.00
IGL01396:Sptbn4 APN 7 27414771 missense probably benign 0.06
IGL01700:Sptbn4 APN 7 27404268 missense probably damaging 1.00
IGL01878:Sptbn4 APN 7 27364146 missense probably damaging 0.99
IGL02066:Sptbn4 APN 7 27364515 missense possibly damaging 0.68
IGL02116:Sptbn4 APN 7 27364357 missense probably benign
IGL02226:Sptbn4 APN 7 27365707 missense probably damaging 1.00
IGL02333:Sptbn4 APN 7 27364299 missense probably damaging 1.00
IGL02337:Sptbn4 APN 7 27428247 missense probably benign 0.03
IGL02451:Sptbn4 APN 7 27365589 missense probably null 0.15
IGL02487:Sptbn4 APN 7 27419097 missense probably damaging 1.00
IGL02530:Sptbn4 APN 7 27391551 missense probably damaging 1.00
IGL02724:Sptbn4 APN 7 27367679 missense probably damaging 1.00
IGL02850:Sptbn4 APN 7 27426833 missense possibly damaging 0.95
IGL02851:Sptbn4 APN 7 27426833 missense possibly damaging 0.95
IGL02869:Sptbn4 APN 7 27394148 splice site probably benign
IGL02961:Sptbn4 APN 7 27397967 missense probably damaging 1.00
ANU22:Sptbn4 UTSW 7 27357387 nonsense probably null
R0194:Sptbn4 UTSW 7 27404911 missense probably benign 0.00
R0328:Sptbn4 UTSW 7 27364170 missense probably damaging 1.00
R0379:Sptbn4 UTSW 7 27359736 splice site probably benign
R0510:Sptbn4 UTSW 7 27361566 critical splice donor site probably null
R0550:Sptbn4 UTSW 7 27364378 missense probably benign 0.16
R0557:Sptbn4 UTSW 7 27408328 nonsense probably null
R1336:Sptbn4 UTSW 7 27417963 missense probably damaging 1.00
R1494:Sptbn4 UTSW 7 27434294 missense probably damaging 1.00
R1630:Sptbn4 UTSW 7 27418739 missense probably benign 0.09
R1803:Sptbn4 UTSW 7 27418583 missense probably damaging 1.00
R1834:Sptbn4 UTSW 7 27366646 missense probably null 0.96
R1906:Sptbn4 UTSW 7 27391431 critical splice donor site probably null
R1924:Sptbn4 UTSW 7 27407138 missense probably damaging 1.00
R1951:Sptbn4 UTSW 7 27366443 missense possibly damaging 0.64
R1989:Sptbn4 UTSW 7 27367702 missense probably damaging 1.00
R1990:Sptbn4 UTSW 7 27423810 missense probably benign 0.19
R2005:Sptbn4 UTSW 7 27366419 nonsense probably null
R2083:Sptbn4 UTSW 7 27428256 missense probably benign 0.29
R2176:Sptbn4 UTSW 7 27364162 missense probably benign 0.21
R2211:Sptbn4 UTSW 7 27367609 missense probably damaging 1.00
R2262:Sptbn4 UTSW 7 27434357 missense probably damaging 1.00
R2263:Sptbn4 UTSW 7 27434357 missense probably damaging 1.00
R2374:Sptbn4 UTSW 7 27360092 missense probably damaging 0.99
R2407:Sptbn4 UTSW 7 27418098 nonsense probably null
R4115:Sptbn4 UTSW 7 27391570 missense probably damaging 1.00
R4116:Sptbn4 UTSW 7 27391570 missense probably damaging 1.00
R4392:Sptbn4 UTSW 7 27418471 missense probably damaging 0.97
R4426:Sptbn4 UTSW 7 27423798 missense probably damaging 1.00
R4535:Sptbn4 UTSW 7 27367702 missense probably damaging 1.00
R4684:Sptbn4 UTSW 7 27364419 missense probably damaging 0.96
R4684:Sptbn4 UTSW 7 27366735 missense possibly damaging 0.60
R4707:Sptbn4 UTSW 7 27417006 missense probably benign 0.12
R4876:Sptbn4 UTSW 7 27372152 missense probably damaging 1.00
R5091:Sptbn4 UTSW 7 27369391 missense probably damaging 1.00
R5371:Sptbn4 UTSW 7 27359741 critical splice donor site probably null
R5790:Sptbn4 UTSW 7 27366428 missense probably damaging 0.99
R5857:Sptbn4 UTSW 7 27418713 missense possibly damaging 0.89
R5908:Sptbn4 UTSW 7 27404253 missense probably benign 0.00
R5980:Sptbn4 UTSW 7 27372171 missense probably damaging 1.00
R6005:Sptbn4 UTSW 7 27418599 missense probably damaging 1.00
R6013:Sptbn4 UTSW 7 27364479 missense probably damaging 0.99
R6037:Sptbn4 UTSW 7 27364170 missense probably damaging 0.97
R6037:Sptbn4 UTSW 7 27364170 missense probably damaging 0.97
R6129:Sptbn4 UTSW 7 27360088 missense probably damaging 0.98
R6146:Sptbn4 UTSW 7 27364587 nonsense probably null
R6762:Sptbn4 UTSW 7 27394208 missense probably damaging 1.00
R6897:Sptbn4 UTSW 7 27371950 missense possibly damaging 0.96
R7178:Sptbn4 UTSW 7 27418056 missense probably damaging 1.00
R7212:Sptbn4 UTSW 7 27416785 missense probably benign 0.44
R7465:Sptbn4 UTSW 7 27366689 missense probably benign 0.00
R7471:Sptbn4 UTSW 7 27409014 missense possibly damaging 0.64
R7510:Sptbn4 UTSW 7 27428268 missense probably benign 0.13
R7527:Sptbn4 UTSW 7 27375590 missense possibly damaging 0.94
R7528:Sptbn4 UTSW 7 27442535 missense probably benign 0.00
R7649:Sptbn4 UTSW 7 27361577 missense possibly damaging 0.80
R7714:Sptbn4 UTSW 7 27364336 missense probably benign 0.02
R7780:Sptbn4 UTSW 7 27361634 missense possibly damaging 0.70
R7854:Sptbn4 UTSW 7 27362410 missense probably benign
R8002:Sptbn4 UTSW 7 27417992 missense possibly damaging 0.91
R8058:Sptbn4 UTSW 7 27364269 missense possibly damaging 0.92
R8181:Sptbn4 UTSW 7 27375383 missense possibly damaging 0.79
R8195:Sptbn4 UTSW 7 27408889 nonsense probably null
R8353:Sptbn4 UTSW 7 27404238 missense probably damaging 1.00
R8392:Sptbn4 UTSW 7 27372296 missense probably damaging 1.00
R8453:Sptbn4 UTSW 7 27404238 missense probably damaging 1.00
X0020:Sptbn4 UTSW 7 27402734 critical splice donor site probably null
X0066:Sptbn4 UTSW 7 27357311 unclassified probably benign
Z1176:Sptbn4 UTSW 7 27360025 missense probably damaging 0.99
Z1177:Sptbn4 UTSW 7 27404582 missense probably damaging 1.00
Z1177:Sptbn4 UTSW 7 27409102 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TTCATCCTGGAAGCACAAGGC -3'
(R):5'- TGACCTAGTCAACCTCAGAGG -3'

Sequencing Primer
(F):5'- CTGTTCTGGGCGCACCTTG -3'
(R):5'- AGGAACTCTGGGTGGAGTCTC -3'
Posted On2019-10-24