Incidental Mutation 'R7636:Olfr1234'
ID 589946
Institutional Source Beutler Lab
Gene Symbol Olfr1234
Ensembl Gene ENSMUSG00000075090
Gene Name olfactory receptor 1234
Synonyms MOR231-2, GA_x6K02T2Q125-50805620-50804676
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R7636 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 89360013-89364865 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 89363239 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 63 (Y63*)
Ref Sequence ENSEMBL: ENSMUSP00000107168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099783] [ENSMUST00000111543] [ENSMUST00000137692]
AlphaFold A2AVK5
Predicted Effect probably null
Transcript: ENSMUST00000099783
AA Change: Y63*
SMART Domains Protein: ENSMUSP00000097371
Gene: ENSMUSG00000075090
AA Change: Y63*

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 5.9e-32 PFAM
Pfam:7tm_4 137 278 1.5e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111543
AA Change: Y63*
SMART Domains Protein: ENSMUSP00000107168
Gene: ENSMUSG00000075090
AA Change: Y63*

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.2e-46 PFAM
Pfam:7tm_1 39 285 7.2e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000137692
AA Change: Y63*
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik C T 16: 17,117,837 E199K possibly damaging Het
4932415D10Rik T A 10: 82,295,139 D679V probably benign Het
Akap13 C A 7: 75,609,873 N748K probably benign Het
Aldh16a1 G T 7: 45,147,531 P58T unknown Het
Amhr2 T A 15: 102,452,458 C343S probably damaging Het
Ankrd17 A T 5: 90,232,380 M2483K possibly damaging Het
Ano3 A T 2: 110,682,703 L649* probably null Het
Apob T C 12: 8,009,516 I2666T possibly damaging Het
C1ql3 A T 2: 13,010,810 V13E probably benign Het
Casp12 A G 9: 5,358,344 I384V probably benign Het
Clcn1 A T 6: 42,291,334 K147* probably null Het
Ctnna1 T A 18: 35,223,473 N398K possibly damaging Het
Dcdc2a A T 13: 25,102,622 K176M probably damaging Het
Depdc5 T A 5: 32,917,983 S502T probably benign Het
Fam166a A T 2: 25,218,820 H7L probably damaging Het
Fam83e G A 7: 45,727,026 D388N probably damaging Het
Fbxl15 G A 19: 46,329,175 E99K probably benign Het
Fbxw2 T C 2: 34,812,944 T186A probably benign Het
Frem2 T A 3: 53,653,247 M1280L probably benign Het
Gbgt1 T A 2: 28,505,314 D321E probably damaging Het
Gsdmc2 T A 15: 63,828,192 T244S probably benign Het
Heatr5a C A 12: 51,888,196 G1675W probably damaging Het
Heatr5a G A 12: 51,952,558 L287F probably damaging Het
Hfm1 C A 5: 106,917,466 A116S probably benign Het
Insr A G 8: 3,258,709 I109T probably damaging Het
Itga4 A G 2: 79,313,832 I688V probably benign Het
Lipe A G 7: 25,388,617 M49T probably benign Het
Lrriq3 A G 3: 155,188,150 Y496C probably damaging Het
Lyst T C 13: 13,616,747 probably null Het
Megf10 T A 18: 57,276,989 I614N possibly damaging Het
Mkx A G 18: 7,000,630 I104T possibly damaging Het
Mrgpra4 C A 7: 47,980,973 L293F possibly damaging Het
Olfm2 A G 9: 20,668,297 V386A possibly damaging Het
Olfr317 A T 11: 58,732,447 N239K possibly damaging Het
Olfr605 C A 7: 103,442,833 D97Y probably damaging Het
Pkd2l1 G T 19: 44,191,431 D113E possibly damaging Het
Rab11fip2 A T 19: 59,942,885 I39K possibly damaging Het
Rab1b A T 19: 5,100,782 V99E probably damaging Het
Rad54l2 A T 9: 106,720,387 L140Q probably damaging Het
Repin1 T C 6: 48,596,365 F76S probably benign Het
Robo1 A G 16: 72,563,727 D9G Het
Scn3a A G 2: 65,497,689 L819P probably damaging Het
Scn7a A T 2: 66,743,828 N150K possibly damaging Het
Sh2d3c T C 2: 32,725,011 S38P probably benign Het
Sin3b A T 8: 72,747,734 K549* probably null Het
Sorl1 A G 9: 42,092,334 F222S possibly damaging Het
Tmem147 A T 7: 30,728,301 probably null Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem179 C T 12: 112,510,743 probably null Het
Tubg2 A T 11: 101,160,087 I213F probably damaging Het
Zfhx3 T C 8: 108,946,809 I1497T probably benign Het
Zfp128 A T 7: 12,890,112 M136L probably benign Het
Zzz3 G A 3: 152,427,652 A116T probably benign Het
Other mutations in Olfr1234
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02134:Olfr1234 APN 2 89362828 missense probably damaging 0.97
R0945:Olfr1234 UTSW 2 89363255 missense probably damaging 0.98
R1018:Olfr1234 UTSW 2 89363179 missense possibly damaging 0.95
R1419:Olfr1234 UTSW 2 89363322 missense probably damaging 1.00
R1872:Olfr1234 UTSW 2 89362589 missense probably damaging 1.00
R1929:Olfr1234 UTSW 2 89363009 missense probably benign 0.01
R2143:Olfr1234 UTSW 2 89363103 missense probably damaging 1.00
R3499:Olfr1234 UTSW 2 89362950 missense probably benign 0.07
R3776:Olfr1234 UTSW 2 89362764 missense possibly damaging 0.69
R4595:Olfr1234 UTSW 2 89363325 missense probably damaging 0.98
R6287:Olfr1234 UTSW 2 89363019 nonsense probably null
R7256:Olfr1234 UTSW 2 89362494 missense probably benign 0.21
R7516:Olfr1234 UTSW 2 89363375 missense probably benign 0.01
R7975:Olfr1234 UTSW 2 89363069 missense probably benign 0.23
R8240:Olfr1234 UTSW 2 89362552 missense probably benign 0.01
R8514:Olfr1234 UTSW 2 89363229 missense probably benign 0.06
R8680:Olfr1234 UTSW 2 89362721 missense probably benign 0.00
R8780:Olfr1234 UTSW 2 89363308 missense probably damaging 1.00
R8898:Olfr1234 UTSW 2 89362613 missense possibly damaging 0.56
R9402:Olfr1234 UTSW 2 89362779 nonsense probably null
R9434:Olfr1234 UTSW 2 89363348 missense probably benign 0.02
R9451:Olfr1234 UTSW 2 89362899 missense probably damaging 1.00
R9632:Olfr1234 UTSW 2 89362721 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCACATAACGGTCATAGGCC -3'
(R):5'- ATCTAAGTGAGTTCAGCACACTC -3'

Sequencing Primer
(F):5'- TAACGGTCATAGGCCATCAC -3'
(R):5'- TGAGTTCAGCACACTCAGAAG -3'
Posted On 2019-10-24