Incidental Mutation 'R7642:Wscd2'
ID590291
Institutional Source Beutler Lab
Gene Symbol Wscd2
Ensembl Gene ENSMUSG00000063430
Gene NameWSC domain containing 2
Synonyms4933413A10Rik, C530024P05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7642 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location113490333-113589725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113577414 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 438 (K438N)
Ref Sequence ENSEMBL: ENSMUSP00000092021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094452]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094452
AA Change: K438N

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000092021
Gene: ENSMUSG00000063430
AA Change: K438N

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 44 61 N/A INTRINSIC
WSC 133 225 6.11e-44 SMART
WSC 236 330 9.49e-41 SMART
Blast:WSC 389 409 2e-6 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b1 T C 13: 94,477,032 S680P probably benign Het
Carmil1 T C 13: 24,067,206 T844A probably benign Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Clca4a A T 3: 144,953,751 D781E probably benign Het
Col10a1 A G 10: 34,395,642 M537V probably benign Het
Col5a2 A G 1: 45,376,088 M1497T probably benign Het
Csmd1 T A 8: 16,085,178 I1655F probably damaging Het
Cts3 A G 13: 61,568,775 S16P probably benign Het
Cyp2c67 T C 19: 39,615,640 Y424C probably damaging Het
Dip2c T C 13: 9,622,705 probably null Het
Dnah5 T C 15: 28,247,979 probably null Het
Dpp4 A G 2: 62,360,283 probably null Het
Fam135b T G 15: 71,479,142 N295T possibly damaging Het
Fign A G 2: 63,980,572 V118A probably benign Het
Gpr108 A T 17: 57,236,228 Y480* probably null Het
Ky T C 9: 102,542,270 V492A probably benign Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lrrc30 C T 17: 67,632,477 G36E probably damaging Het
Map2 T C 1: 66,413,307 V452A probably benign Het
Mks1 C T 11: 87,856,840 T183M possibly damaging Het
Mpg G A 11: 32,229,517 probably null Het
Nat10 A G 2: 103,726,786 L841P possibly damaging Het
Nbeal1 A G 1: 60,277,227 E1863G probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nr2e3 T A 9: 59,947,388 I292F possibly damaging Het
Nxn T C 11: 76,272,459 Y246C probably damaging Het
Olfr1048 A T 2: 86,236,316 L166* probably null Het
Olfr1289 T C 2: 111,483,478 F44S probably damaging Het
Olfr194 T G 16: 59,119,648 T141P possibly damaging Het
Olfr196 A G 16: 59,167,717 V142A probably benign Het
Olfr98 A T 17: 37,263,073 M197K probably benign Het
Pcdha5 T A 18: 36,960,491 F18I probably benign Het
Pcdhb17 A G 18: 37,485,726 K190E probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Ppm1g G T 5: 31,205,103 Y284* probably null Het
Rp1 A G 1: 4,147,831 V1026A unknown Het
Scap C T 9: 110,374,013 R252C probably damaging Het
Scn9a C A 2: 66,536,236 K734N probably benign Het
Sema5a C T 15: 32,682,325 S955F probably damaging Het
Serpinb10 A G 1: 107,529,101 probably null Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Sh2d5 A G 4: 138,259,156 T397A probably benign Het
Slc22a8 T C 19: 8,610,045 F490L probably benign Het
Tbc1d19 A T 5: 53,856,918 Y296F probably damaging Het
Tmppe T C 9: 114,404,794 S54P possibly damaging Het
Vmn1r123 A T 7: 21,162,870 N229I probably benign Het
Wdr36 T A 18: 32,854,571 probably null Het
Wdr47 T A 3: 108,643,164 M835K possibly damaging Het
Xrcc6 T A 15: 82,016,477 probably null Het
Xrn1 T A 9: 96,021,853 F1148I possibly damaging Het
Zmynd8 T C 2: 165,812,426 D722G probably damaging Het
Other mutations in Wscd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Wscd2 APN 5 113551175 missense possibly damaging 0.56
IGL01113:Wscd2 APN 5 113570739 missense probably damaging 1.00
IGL01476:Wscd2 APN 5 113572321 missense probably damaging 0.99
IGL01894:Wscd2 APN 5 113572296 missense probably damaging 0.96
IGL02560:Wscd2 APN 5 113560984 missense probably benign 0.01
IGL02755:Wscd2 APN 5 113574031 missense possibly damaging 0.66
R0381:Wscd2 UTSW 5 113551131 missense probably damaging 0.96
R1144:Wscd2 UTSW 5 113561090 splice site probably null
R1858:Wscd2 UTSW 5 113551170 missense possibly damaging 0.63
R3695:Wscd2 UTSW 5 113551017 missense possibly damaging 0.82
R4231:Wscd2 UTSW 5 113560984 missense probably benign 0.00
R4232:Wscd2 UTSW 5 113560984 missense probably benign 0.00
R4667:Wscd2 UTSW 5 113577272 missense probably damaging 1.00
R4696:Wscd2 UTSW 5 113551179 missense probably benign
R5727:Wscd2 UTSW 5 113577350 missense possibly damaging 0.89
R6401:Wscd2 UTSW 5 113588145 makesense probably null
R7413:Wscd2 UTSW 5 113577341 missense probably benign 0.02
R7837:Wscd2 UTSW 5 113572333 missense probably damaging 1.00
R7920:Wscd2 UTSW 5 113572333 missense probably damaging 1.00
R8046:Wscd2 UTSW 5 113551115 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TAACTTCTCGGCTCGGGTTG -3'
(R):5'- GTGAACTACCCAGGCTTTTGC -3'

Sequencing Primer
(F):5'- TTGGGCACAGGGTTCAAAG -3'
(R):5'- GAAAGTCAGAATCCTTAGCTACTGG -3'
Posted On2019-10-24