Incidental Mutation 'R7642:Olfr1289'
ID590283
Institutional Source Beutler Lab
Gene Symbol Olfr1289
Ensembl Gene ENSMUSG00000061195
Gene Nameolfactory receptor 1289
SynonymsGA_x6K02T2Q125-72534883-72535821, MOR245-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R7642 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111480819-111484615 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111483478 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 44 (F44S)
Ref Sequence ENSEMBL: ENSMUSP00000146801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104889] [ENSMUST00000120021] [ENSMUST00000207494] [ENSMUST00000214816] [ENSMUST00000217611]
Predicted Effect probably benign
Transcript: ENSMUST00000104889
SMART Domains Protein: ENSMUSP00000100485
Gene: ENSMUSG00000044039

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 1.3e-43 PFAM
Pfam:7tm_1 41 287 2.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120021
AA Change: F44S

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000207494
AA Change: F16S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000214816
Predicted Effect probably benign
Transcript: ENSMUST00000217611
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b1 T C 13: 94,477,032 S680P probably benign Het
Carmil1 T C 13: 24,067,206 T844A probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Clca4a A T 3: 144,953,751 D781E probably benign Het
Col10a1 A G 10: 34,395,642 M537V probably benign Het
Col5a2 A G 1: 45,376,088 M1497T probably benign Het
Csmd1 T A 8: 16,085,178 I1655F probably damaging Het
Cts3 A G 13: 61,568,775 S16P probably benign Het
Cyp2c67 T C 19: 39,615,640 Y424C probably damaging Het
Dip2c T C 13: 9,622,705 probably null Het
Dnah5 T C 15: 28,247,979 probably null Het
Dpp4 A G 2: 62,360,283 probably null Het
Fam135b T G 15: 71,479,142 N295T possibly damaging Het
Fign A G 2: 63,980,572 V118A probably benign Het
Gpr108 A T 17: 57,236,228 Y480* probably null Het
Ky T C 9: 102,542,270 V492A probably benign Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lrrc30 C T 17: 67,632,477 G36E probably damaging Het
Map2 T C 1: 66,413,307 V452A probably benign Het
Mks1 C T 11: 87,856,840 T183M possibly damaging Het
Mpg G A 11: 32,229,517 probably null Het
Nat10 A G 2: 103,726,786 L841P possibly damaging Het
Nbeal1 A G 1: 60,277,227 E1863G probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nr2e3 T A 9: 59,947,388 I292F possibly damaging Het
Nxn T C 11: 76,272,459 Y246C probably damaging Het
Olfr1048 A T 2: 86,236,316 L166* probably null Het
Olfr194 T G 16: 59,119,648 T141P possibly damaging Het
Olfr196 A G 16: 59,167,717 V142A probably benign Het
Olfr98 A T 17: 37,263,073 M197K probably benign Het
Pcdha5 T A 18: 36,960,491 F18I probably benign Het
Pcdhb17 A G 18: 37,485,726 K190E probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Ppm1g G T 5: 31,205,103 Y284* probably null Het
Rp1 A G 1: 4,147,831 V1026A unknown Het
Scap C T 9: 110,374,013 R252C probably damaging Het
Scn9a C A 2: 66,536,236 K734N probably benign Het
Sema5a C T 15: 32,682,325 S955F probably damaging Het
Serpinb10 A G 1: 107,529,101 probably null Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Sh2d5 A G 4: 138,259,156 T397A probably benign Het
Slc22a8 T C 19: 8,610,045 F490L probably benign Het
Tbc1d19 A T 5: 53,856,918 Y296F probably damaging Het
Tmppe T C 9: 114,404,794 S54P possibly damaging Het
Vmn1r123 A T 7: 21,162,870 N229I probably benign Het
Wdr36 T A 18: 32,854,571 probably null Het
Wdr47 T A 3: 108,643,164 M835K possibly damaging Het
Wscd2 A T 5: 113,577,414 K438N possibly damaging Het
Xrcc6 T A 15: 82,016,477 probably null Het
Xrn1 T A 9: 96,021,853 F1148I possibly damaging Het
Zmynd8 T C 2: 165,812,426 D722G probably damaging Het
Other mutations in Olfr1289
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Olfr1289 APN 2 111484101 missense probably damaging 1.00
IGL01682:Olfr1289 APN 2 111483843 missense probably damaging 1.00
IGL02028:Olfr1289 APN 2 111483471 missense probably benign 0.01
IGL02731:Olfr1289 APN 2 111483528 missense probably benign 0.00
IGL03035:Olfr1289 APN 2 111483823 missense probably benign 0.04
R1214:Olfr1289 UTSW 2 111483892 missense probably damaging 1.00
R1471:Olfr1289 UTSW 2 111484006 missense probably damaging 1.00
R1714:Olfr1289 UTSW 2 111483663 missense probably damaging 1.00
R2088:Olfr1289 UTSW 2 111484278 missense probably damaging 1.00
R2136:Olfr1289 UTSW 2 111483616 missense probably damaging 1.00
R2141:Olfr1289 UTSW 2 111483630 missense probably benign 0.23
R3945:Olfr1289 UTSW 2 111483687 nonsense probably null
R4276:Olfr1289 UTSW 2 111483504 missense probably damaging 1.00
R4562:Olfr1289 UTSW 2 111483564 missense probably benign 0.00
R4896:Olfr1289 UTSW 2 111483660 missense possibly damaging 0.82
R4946:Olfr1289 UTSW 2 111483966 missense possibly damaging 0.93
R5004:Olfr1289 UTSW 2 111483660 missense possibly damaging 0.82
R5686:Olfr1289 UTSW 2 111484143 missense probably damaging 1.00
R6032:Olfr1289 UTSW 2 111483850 missense probably damaging 1.00
R6032:Olfr1289 UTSW 2 111483850 missense probably damaging 1.00
R6960:Olfr1289 UTSW 2 111483726 missense possibly damaging 0.70
R7293:Olfr1289 UTSW 2 111483354 splice site probably null
R8429:Olfr1289 UTSW 2 111483495 missense possibly damaging 0.55
R8447:Olfr1289 UTSW 2 111483756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAAGACCTTAATGGGTGAGC -3'
(R):5'- CCCTTAACAGAGATGACTTTGCG -3'

Sequencing Primer
(F):5'- CCTTAATGGGTGAGCAGAGG -3'
(R):5'- AACAGAGATGACTTTGCGTTTGTAG -3'
Posted On2019-10-24