Incidental Mutation 'R7642:Peg3'
ID590292
Institutional Source Beutler Lab
Gene Symbol Peg3
Ensembl Gene ENSMUSG00000002265
Gene Namepaternally expressed 3
SynonymsZfp102, Gcap4, Pw1, End4
MMRRC Submission
Accession Numbers

Genbank: NM_008817; MGI: 104748

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7642 (G1)
Quality Score106.525
Status Validated
Chromosome7
Chromosomal Location6703892-6730431 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC to GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC at 6709168 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051209] [ENSMUST00000143703] [ENSMUST00000150182]
Predicted Effect probably benign
Transcript: ENSMUST00000051209
SMART Domains Protein: ENSMUSP00000050750
Gene: ENSMUSG00000002265

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 213 221 N/A INTRINSIC
ZnF_C2H2 325 347 7.26e-3 SMART
ZnF_C2H2 378 400 6.88e-4 SMART
ZnF_C2H2 436 458 2.95e-3 SMART
low complexity region 464 496 N/A INTRINSIC
ZnF_C2H2 520 542 5.99e-4 SMART
low complexity region 691 698 N/A INTRINSIC
ZnF_C2H2 850 872 2.99e-4 SMART
ZnF_C2H2 1091 1113 2.05e-2 SMART
ZnF_C2H2 1147 1169 1.04e-3 SMART
ZnF_C2H2 1209 1231 1.38e-3 SMART
ZnF_C2H2 1266 1289 1.89e-1 SMART
ZnF_C2H2 1317 1339 1.57e2 SMART
low complexity region 1373 1419 N/A INTRINSIC
low complexity region 1440 1486 N/A INTRINSIC
ZnF_C2H2 1488 1510 2.2e-2 SMART
ZnF_C2H2 1547 1569 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143703
SMART Domains Protein: ENSMUSP00000122423
Gene: ENSMUSG00000002265

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150182
SMART Domains Protein: ENSMUSP00000116161
Gene: ENSMUSG00000002265

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, ZIM2 and PEG3 are treated as two distinct genes though they share multiple 5' exons and a common promoter and both genes are paternally expressed (PMID:15203203). Alternative splicing events connect their shared 5' exons either with the remaining 4 exons unique to ZIM2, or with the remaining 2 exons unique to PEG3. In contrast, in other mammals ZIM2 does not undergo imprinting and, in mouse, cow, and likely other mammals as well, the ZIM2 and PEG3 genes do not share exons. Human PEG3 protein belongs to the Kruppel C2H2-type zinc finger protein family. PEG3 may play a role in cell proliferation and p53-mediated apoptosis. PEG3 has also shown tumor suppressor activity and tumorigenesis in glioma and ovarian cells. Alternative splicing of this PEG3 gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2009]
PHENOTYPE: Heterozygous mutant females exhibit growth retardation, impaired maternal behavior and diminished milk ejection, and fewer oxytocin neurons. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Gene trapped(3)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b1 T C 13: 94,477,032 S680P probably benign Het
Carmil1 T C 13: 24,067,206 T844A probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Clca4a A T 3: 144,953,751 D781E probably benign Het
Col10a1 A G 10: 34,395,642 M537V probably benign Het
Col5a2 A G 1: 45,376,088 M1497T probably benign Het
Csmd1 T A 8: 16,085,178 I1655F probably damaging Het
Cts3 A G 13: 61,568,775 S16P probably benign Het
Cyp2c67 T C 19: 39,615,640 Y424C probably damaging Het
Dip2c T C 13: 9,622,705 probably null Het
Dnah5 T C 15: 28,247,979 probably null Het
Dpp4 A G 2: 62,360,283 probably null Het
Fam135b T G 15: 71,479,142 N295T possibly damaging Het
Fign A G 2: 63,980,572 V118A probably benign Het
Gpr108 A T 17: 57,236,228 Y480* probably null Het
Ky T C 9: 102,542,270 V492A probably benign Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lrrc30 C T 17: 67,632,477 G36E probably damaging Het
Map2 T C 1: 66,413,307 V452A probably benign Het
Mks1 C T 11: 87,856,840 T183M possibly damaging Het
Mpg G A 11: 32,229,517 probably null Het
Nat10 A G 2: 103,726,786 L841P possibly damaging Het
Nbeal1 A G 1: 60,277,227 E1863G probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nr2e3 T A 9: 59,947,388 I292F possibly damaging Het
Nxn T C 11: 76,272,459 Y246C probably damaging Het
Olfr1048 A T 2: 86,236,316 L166* probably null Het
Olfr1289 T C 2: 111,483,478 F44S probably damaging Het
Olfr194 T G 16: 59,119,648 T141P possibly damaging Het
Olfr196 A G 16: 59,167,717 V142A probably benign Het
Olfr98 A T 17: 37,263,073 M197K probably benign Het
Pcdha5 T A 18: 36,960,491 F18I probably benign Het
Pcdhb17 A G 18: 37,485,726 K190E probably damaging Het
Ppm1g G T 5: 31,205,103 Y284* probably null Het
Rp1 A G 1: 4,147,831 V1026A unknown Het
Scap C T 9: 110,374,013 R252C probably damaging Het
Scn9a C A 2: 66,536,236 K734N probably benign Het
Sema5a C T 15: 32,682,325 S955F probably damaging Het
Serpinb10 A G 1: 107,529,101 probably null Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Sh2d5 A G 4: 138,259,156 T397A probably benign Het
Slc22a8 T C 19: 8,610,045 F490L probably benign Het
Tbc1d19 A T 5: 53,856,918 Y296F probably damaging Het
Tmppe T C 9: 114,404,794 S54P possibly damaging Het
Vmn1r123 A T 7: 21,162,870 N229I probably benign Het
Wdr36 T A 18: 32,854,571 probably null Het
Wdr47 T A 3: 108,643,164 M835K possibly damaging Het
Wscd2 A T 5: 113,577,414 K438N possibly damaging Het
Xrcc6 T A 15: 82,016,477 probably null Het
Xrn1 T A 9: 96,021,853 F1148I possibly damaging Het
Zmynd8 T C 2: 165,812,426 D722G probably damaging Het
Other mutations in Peg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Peg3 APN 7 6710274 missense probably benign 0.09
IGL01410:Peg3 APN 7 6707625 missense probably benign 0.04
IGL01415:Peg3 APN 7 6711653 missense probably damaging 0.99
IGL02073:Peg3 APN 7 6711002 missense probably damaging 1.00
IGL02193:Peg3 APN 7 6711928 missense probably damaging 1.00
IGL02212:Peg3 APN 7 6711416 missense probably benign 0.41
IGL02215:Peg3 APN 7 6709011 missense probably benign 0.00
IGL02407:Peg3 APN 7 6707636 missense probably damaging 0.99
IGL02586:Peg3 APN 7 6710069 missense probably benign
IGL02673:Peg3 APN 7 6710414 missense probably damaging 1.00
IGL02935:Peg3 APN 7 6711129 missense probably damaging 1.00
IGL03277:Peg3 APN 7 6711674 missense probably damaging 1.00
IGL03330:Peg3 APN 7 6710413 missense probably damaging 1.00
IGL03393:Peg3 APN 7 6707649 missense probably damaging 0.99
R0049:Peg3 UTSW 7 6711673 missense possibly damaging 0.85
R0049:Peg3 UTSW 7 6711673 missense possibly damaging 0.85
R0518:Peg3 UTSW 7 6711428 missense probably damaging 1.00
R0521:Peg3 UTSW 7 6711428 missense probably damaging 1.00
R1477:Peg3 UTSW 7 6716142 missense probably damaging 1.00
R1716:Peg3 UTSW 7 6707781 missense possibly damaging 0.93
R1721:Peg3 UTSW 7 6709901 missense possibly damaging 0.92
R1732:Peg3 UTSW 7 6709085 missense possibly damaging 0.72
R2051:Peg3 UTSW 7 6712721 missense probably damaging 0.96
R2288:Peg3 UTSW 7 6709115 missense probably damaging 0.96
R3606:Peg3 UTSW 7 6708509 missense probably damaging 1.00
R5075:Peg3 UTSW 7 6708420 missense probably damaging 1.00
R5076:Peg3 UTSW 7 6708420 missense probably damaging 1.00
R5084:Peg3 UTSW 7 6707849 missense probably damaging 1.00
R5097:Peg3 UTSW 7 6710027 missense probably damaging 0.99
R5121:Peg3 UTSW 7 6710289 missense probably benign 0.20
R5141:Peg3 UTSW 7 6709382 missense probably benign 0.03
R5292:Peg3 UTSW 7 6708260 missense probably damaging 1.00
R5294:Peg3 UTSW 7 6717849 missense possibly damaging 0.88
R5342:Peg3 UTSW 7 6709970 missense probably damaging 1.00
R5415:Peg3 UTSW 7 6708629 missense probably benign
R5906:Peg3 UTSW 7 6717855 missense probably damaging 0.99
R6056:Peg3 UTSW 7 6709571 missense probably damaging 1.00
R6259:Peg3 UTSW 7 6709811 missense probably damaging 0.99
R6529:Peg3 UTSW 7 6708072 missense probably damaging 1.00
R6631:Peg3 UTSW 7 6709070 missense possibly damaging 0.72
R6855:Peg3 UTSW 7 6708798 missense probably benign 0.13
R6861:Peg3 UTSW 7 6711386 nonsense probably null
R6864:Peg3 UTSW 7 6712762 missense probably damaging 1.00
R6892:Peg3 UTSW 7 6708899 missense possibly damaging 0.58
R7018:Peg3 UTSW 7 6708839 missense possibly damaging 0.72
R7039:Peg3 UTSW 7 6717859 missense probably damaging 0.99
R7066:Peg3 UTSW 7 6708857 missense probably damaging 1.00
R7117:Peg3 UTSW 7 6709168 unclassified probably benign
R7133:Peg3 UTSW 7 6708945 missense probably damaging 1.00
R7493:Peg3 UTSW 7 6709724 missense probably damaging 1.00
R7539:Peg3 UTSW 7 6708168 missense probably benign 0.00
R7646:Peg3 UTSW 7 6709222 missense probably benign
R7658:Peg3 UTSW 7 6709610 missense probably damaging 1.00
R7846:Peg3 UTSW 7 6710651 missense probably damaging 1.00
R7853:Peg3 UTSW 7 6708840 missense possibly damaging 0.72
R7903:Peg3 UTSW 7 6709168 unclassified probably benign
R7913:Peg3 UTSW 7 6709168 unclassified probably benign
R7948:Peg3 UTSW 7 6708782 missense probably damaging 1.00
R8219:Peg3 UTSW 7 6708365 missense probably benign 0.00
R8385:Peg3 UTSW 7 6708083 missense probably damaging 1.00
R8672:Peg3 UTSW 7 6708524 missense possibly damaging 0.62
RF039:Peg3 UTSW 7 6709168 unclassified probably benign
YA93:Peg3 UTSW 7 6711647 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGCATCACCAGCGTCATC -3'
(R):5'- AGCCATATGGTAAGGAGCCCAG -3'

Sequencing Primer
(F):5'- TGCTCTTCAGAAACTGAGGC -3'
(R):5'- AGTGAAGAGCCCCATGAT -3'
Posted On2019-10-24