Incidental Mutation 'R0234:Syn3'
ID59050
Institutional Source Beutler Lab
Gene Symbol Syn3
Ensembl Gene ENSMUSG00000059602
Gene Namesynapsin III
SynonymsSynapsin IIIa
MMRRC Submission 038475-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0234 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location86055125-86498896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86448886 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 117 (I117F)
Ref Sequence ENSEMBL: ENSMUSP00000113720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120638] [ENSMUST00000121789]
Predicted Effect possibly damaging
Transcript: ENSMUST00000120638
AA Change: I117F

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113720
Gene: ENSMUSG00000059602
AA Change: I117F

DomainStartEndE-ValueType
Pfam:Synapsin_N 1 32 8.7e-22 PFAM
low complexity region 47 66 N/A INTRINSIC
low complexity region 80 88 N/A INTRINSIC
Pfam:Synapsin 89 190 1.8e-46 PFAM
Pfam:Synapsin_C 192 394 6.8e-141 PFAM
low complexity region 418 485 N/A INTRINSIC
low complexity region 535 551 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121789
AA Change: I117F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113408
Gene: ENSMUSG00000059602
AA Change: I117F

DomainStartEndE-ValueType
Pfam:Synapsin_N 1 32 2.2e-25 PFAM
low complexity region 47 66 N/A INTRINSIC
Pfam:Synapsin 87 190 3.6e-63 PFAM
Pfam:Synapsin_C 192 242 6.7e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139197
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145864
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the synapsin gene family. Synapsins encode neuronal phosphoproteins which associate with the cytoplasmic surface of synaptic vesicles. Family members are characterized by common protein domains, and they are implicated in synaptogenesis and the modulation of neurotransmitter release, suggesting a potential role in several neuropsychiatric diseases. The protein encoded by this gene shares the synapsin family domain model, with domains A, C, and E exhibiting the highest degree of conservation. The protein contains a unique domain J, located between domains C and E. Based on this gene's localization to 22q12.3, a possible schizophrenia susceptibility locus, and the established neurobiological roles of the synapsins, this family member may represent a candidate gene for schizophrenia. The TIMP3 gene is located within an intron of this gene and is transcribed in the opposite direction. Alternative splicing of this gene results in multiple splice variants that encode different isoforms. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display altered neurotransmitter release, reduced synaptic depression, and a specific delay in early axon outgrowth in cultured hippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T A 7: 131,194,303 probably null Het
A3galt2 A G 4: 128,767,148 R197G possibly damaging Het
Acacb A T 5: 114,209,817 H983L probably damaging Het
Adal T A 2: 121,148,317 D139E probably benign Het
Adam6b G A 12: 113,490,610 R349H probably damaging Het
Agap1 A G 1: 89,671,212 K331E probably damaging Het
Alyref T C 11: 120,598,307 D11G probably damaging Het
B3gat1 A G 9: 26,756,081 E203G probably damaging Het
Bsn T C 9: 108,116,396 E719G possibly damaging Het
Cap2 G C 13: 46,638,022 probably null Het
Ccni A G 5: 93,202,327 V31A probably benign Het
Cfap54 A T 10: 92,899,160 L2343* probably null Het
Clns1a T A 7: 97,714,032 Y204N possibly damaging Het
Cox11 C T 11: 90,644,500 T259I probably damaging Het
D430042O09Rik T C 7: 125,795,385 V211A probably benign Het
Dsp A G 13: 38,187,893 N940S probably benign Het
Erbb2 T C 11: 98,436,439 V1181A probably benign Het
Exoc4 T C 6: 33,862,087 V686A possibly damaging Het
F830045P16Rik A G 2: 129,463,464 V330A possibly damaging Het
Fam71a T C 1: 191,162,908 S513G probably benign Het
Fbf1 A C 11: 116,155,034 F245V probably damaging Het
Fut10 T A 8: 31,236,197 F327I probably damaging Het
Galnt1 C T 18: 24,254,633 P144S probably damaging Het
Ghrhr A T 6: 55,379,186 D88V possibly damaging Het
Greb1l T A 18: 10,560,331 C1864S probably damaging Het
Hist1h1c T C 13: 23,739,123 I92T probably benign Het
Hps1 T C 19: 42,762,553 E336G probably damaging Het
Ibsp GGAAGAAGAAGAAGAAGA GGAAGAAGAAGAAGA 5: 104,310,069 probably benign Het
Irgc1 C A 7: 24,433,328 E21D possibly damaging Het
Itsn1 A T 16: 91,828,280 R590* probably null Het
Lmln T C 16: 33,066,324 V67A probably damaging Het
Lsm14a T C 7: 34,365,617 Q179R probably damaging Het
Ltbr A C 6: 125,312,873 D119E probably benign Het
Mrc1 A G 2: 14,279,894 T565A possibly damaging Het
Muc6 A C 7: 141,649,674 N473K possibly damaging Het
Myocd A T 11: 65,187,240 D448E probably benign Het
Neil2 T A 14: 63,183,526 I239F probably damaging Het
Npnt A G 3: 132,914,414 F123S possibly damaging Het
Olfr1164 T A 2: 88,093,022 R305* probably null Het
Olfr117 T A 17: 37,660,106 I76F probably damaging Het
Olfr1309 T C 2: 111,983,300 Y258C probably damaging Het
Olfr1501 C T 19: 13,838,538 V212M possibly damaging Het
Olfr683 T C 7: 105,144,074 D73G probably damaging Het
Olfr686 C A 7: 105,203,614 C243F probably damaging Het
Olfr933 A C 9: 38,976,251 probably null Het
Pcnx3 T C 19: 5,672,618 T941A probably benign Het
Phldb3 G A 7: 24,612,579 R106Q probably benign Het
Pitrm1 C A 13: 6,575,079 Y864* probably null Het
Plcb4 T C 2: 135,982,075 I844T probably benign Het
Plekhg5 T C 4: 152,112,219 C695R probably damaging Het
Ppp1r3b T A 8: 35,384,501 F165I probably damaging Het
Prr5 T A 15: 84,703,121 F357L probably damaging Het
Rasgrf1 A T 9: 90,009,366 I1046F probably damaging Het
Rbm15b T C 9: 106,885,364 Y535C probably damaging Het
Rbp3 A T 14: 33,955,901 E602V probably damaging Het
Rimklb T C 6: 122,456,333 N343S probably benign Het
Rrp12 A G 19: 41,871,760 L1008P probably damaging Het
Sec63 C T 10: 42,798,798 R226C probably damaging Het
Sirpa T C 2: 129,615,468 V154A probably damaging Het
Slc13a5 C G 11: 72,250,800 V405L probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc22a23 G A 13: 34,183,261 T588I probably damaging Het
Slc22a27 C A 19: 7,926,791 probably benign Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc5a5 A T 8: 70,889,633 M258K probably damaging Het
Spry4 A G 18: 38,590,089 I207T possibly damaging Het
Stk11ip A G 1: 75,529,067 D460G possibly damaging Het
Tead4 C T 6: 128,243,402 A224T probably damaging Het
Tmtc3 A T 10: 100,450,322 N546K probably benign Het
Tnn T A 1: 160,088,466 H1227L probably damaging Het
Tor2a G A 2: 32,758,704 G62D probably damaging Het
Trf T C 9: 103,226,879 probably null Het
Ubr5 T C 15: 37,968,493 T2727A probably damaging Het
Vmn2r27 T A 6: 124,231,619 T56S probably benign Het
Wipf3 T G 6: 54,496,501 L458R probably damaging Het
Zfp236 T C 18: 82,629,994 K966R probably damaging Het
Zfp27 T A 7: 29,894,107 H811L possibly damaging Het
Zfp366 A G 13: 99,234,260 H496R probably damaging Het
Zfp467 A T 6: 48,438,755 V321E probably damaging Het
Other mutations in Syn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Syn3 APN 10 86354416 missense probably damaging 1.00
IGL02391:Syn3 APN 10 86064906 missense probably benign 0.22
IGL02598:Syn3 APN 10 86467199 missense probably damaging 0.99
IGL03007:Syn3 APN 10 86064914 missense possibly damaging 0.57
IGL03379:Syn3 APN 10 86064872 missense possibly damaging 0.80
R0234:Syn3 UTSW 10 86448886 missense possibly damaging 0.64
R1577:Syn3 UTSW 10 86448864 critical splice donor site probably null
R1597:Syn3 UTSW 10 86135044 missense probably benign 0.16
R1699:Syn3 UTSW 10 86080211 missense probably damaging 1.00
R1916:Syn3 UTSW 10 86354344 critical splice donor site probably null
R2006:Syn3 UTSW 10 86073233 missense probably benign 0.20
R2025:Syn3 UTSW 10 86466982 missense probably damaging 0.97
R4413:Syn3 UTSW 10 86055592 unclassified probably benign
R4904:Syn3 UTSW 10 86467086 missense possibly damaging 0.91
R5050:Syn3 UTSW 10 86407668 missense probably benign 0.05
R5286:Syn3 UTSW 10 86351564 missense possibly damaging 0.93
R5449:Syn3 UTSW 10 86351570 missense probably damaging 1.00
R5507:Syn3 UTSW 10 86080226 missense probably benign 0.01
R5792:Syn3 UTSW 10 86294628 makesense probably null
R6525:Syn3 UTSW 10 86467052 missense probably damaging 0.99
R6605:Syn3 UTSW 10 86057564 missense unknown
R7000:Syn3 UTSW 10 86080252 missense probably damaging 1.00
R7619:Syn3 UTSW 10 86057564 missense unknown
R7661:Syn3 UTSW 10 86069076 missense probably damaging 1.00
R7710:Syn3 UTSW 10 86407670 missense probably damaging 0.98
R7730:Syn3 UTSW 10 86448909 missense probably benign 0.05
R7798:Syn3 UTSW 10 86080253 missense probably damaging 1.00
R7819:Syn3 UTSW 10 86055540 unclassified probably benign
X0023:Syn3 UTSW 10 86354477 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GGAAGATTCTGGCGCTTACTGAGAC -3'
(R):5'- GCATGGCTTTCATTTAGAGGCTGC -3'

Sequencing Primer
(F):5'- TTACTGAGACTCCCGAGTACAG -3'
(R):5'- GAGGCCAAGTCACTGGAC -3'
Posted On2013-07-11