Incidental Mutation 'R7672:Cd244'
ID592197
Institutional Source Beutler Lab
Gene Symbol Cd244
Ensembl Gene ENSMUSG00000004709
Gene NameCD244 natural killer cell receptor 2B4
Synonyms2B4, C9.1, F730046O15Rik, Nmrk
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7672 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location171559193-171609746 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 171577285 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 235 (V235A)
Ref Sequence ENSEMBL: ENSMUSP00000004829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004829] [ENSMUST00000194797]
PDB Structure
NMR structure of the D1 domain of the Natural Killer Cell Receptor, 2B4 [SOLUTION NMR]
Structure of NK cell receptor 2B4 (CD244) bound to its ligand CD48 [X-RAY DIFFRACTION]
Structure of NK cell receptor 2B4 (CD244) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000004829
AA Change: V235A

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000004829
Gene: ENSMUSG00000004709
AA Change: V235A

DomainStartEndE-ValueType
IG 26 128 4.23e-2 SMART
Blast:IG_like 146 222 8e-19 BLAST
transmembrane domain 226 248 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000194797
AA Change: V235A

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141898
Gene: ENSMUSG00000004709
AA Change: V235A

DomainStartEndE-ValueType
IG 26 128 4.23e-2 SMART
Pfam:Ig_2 134 221 6.5e-5 PFAM
transmembrane domain 226 248 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface receptor expressed on natural killer (NK) cells (and some T cells) that mediate non-major histocompatibility complex (MHC) restricted killing. The interaction between NK-cell and target cells via this receptor is thought to modulate NK-cell cytolytic activity. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered natural killer (NK) cell cytolysis. Mice homozygous for an ENU-generated allele exhibit reduced 'missing-self' targets recognition and elimination and increased clearance of B16 melanoma tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,237,019 H134R probably damaging Het
Adcy4 A G 14: 55,780,905 M195T probably benign Het
Aktip T C 8: 91,129,657 N64S possibly damaging Het
Aldoart1 C A 4: 72,852,510 M20I probably benign Het
Alms1 T C 6: 85,615,351 L395P probably damaging Het
Ankrd9 C A 12: 110,976,746 V252F probably benign Het
Apof A T 10: 128,269,016 H13L probably benign Het
Bahcc1 T C 11: 120,283,346 F1644S possibly damaging Het
Baz2a A G 10: 128,123,857 D1377G possibly damaging Het
Bbox1 T A 2: 110,305,449 I62F probably damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTG GTTCTGTGGTCACTGATTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTG 3: 95,888,143 probably benign Het
BC028528 TCTGTGGTCACTGGT TCTGTGGTCACTGGTGCTGTGGTCACTGGT 3: 95,888,175 probably benign Het
Bcas3 C T 11: 85,395,387 R124* probably null Het
Bpnt1 T C 1: 185,346,682 V114A probably damaging Het
Ccnd1 C T 7: 144,934,056 R228H possibly damaging Het
Cramp1l C T 17: 24,982,466 E681K probably damaging Het
Crebbp C T 16: 4,084,710 A2222T probably benign Het
Cyp1a2 T A 9: 57,682,337 T65S probably benign Het
Cyp26b1 T G 6: 84,584,369 K104Q probably benign Het
D430041D05Rik T C 2: 104,241,236 I556V probably benign Het
Dnase1l2 A G 17: 24,442,245 L102P probably damaging Het
Elac1 C T 18: 73,738,854 G357S probably benign Het
Enam C A 5: 88,503,971 T1113N possibly damaging Het
Eogt A T 6: 97,113,909 I423N probably damaging Het
Epc2 T C 2: 49,545,819 S612P possibly damaging Het
Fam107b T C 2: 3,772,922 V24A probably damaging Het
Fam160b1 A G 19: 57,385,318 H670R possibly damaging Het
Foxj3 C T 4: 119,620,232 P413L unknown Het
Frg1 T C 8: 41,417,003 probably benign Het
Fsip2 T A 2: 82,990,111 V5396D possibly damaging Het
Gm49333 C A 16: 20,638,667 A483E probably damaging Het
Hdlbp T C 1: 93,437,099 T149A possibly damaging Het
Heatr1 A T 13: 12,438,664 Q2140L probably damaging Het
Iqcd T C 5: 120,606,816 L403P probably damaging Het
Kif1bp A G 10: 62,578,073 I102T probably benign Het
Kpna2 T G 11: 106,988,963 N505T probably benign Het
Lipo1 T A 19: 33,780,385 E228V probably benign Het
Map4k3 C T 17: 80,615,071 V474I possibly damaging Het
Mrpl11 T C 19: 4,962,396 S2P probably damaging Het
Mug2 A G 6: 122,040,719 I472V probably benign Het
Myom1 G A 17: 71,084,240 V915M possibly damaging Het
Nedd9 A T 13: 41,338,722 I104N possibly damaging Het
Nphp3 A G 9: 104,031,960 M790V probably benign Het
Nr3c2 C T 8: 76,909,209 P313L probably damaging Het
Obsl1 A G 1: 75,492,721 V1192A probably benign Het
Olfr1101 T C 2: 86,988,319 I286V possibly damaging Het
Olfr418 C T 1: 173,270,873 R233W probably benign Het
Olfr676 A G 7: 105,035,543 H115R probably damaging Het
Prr5l T G 2: 101,734,738 E151A probably damaging Het
Psmb8 G T 17: 34,198,430 R11L probably benign Het
Ptprg T A 14: 12,211,668 H983Q probably benign Het
Ptprj T C 2: 90,460,596 N600D possibly damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rc3h1 A G 1: 160,950,884 S460G probably damaging Het
Rhot2 A G 17: 25,843,105 probably null Het
Sall1 T C 8: 89,031,299 T726A probably damaging Het
Samd9l G A 6: 3,373,646 T1205I probably benign Het
Sh2b3 C T 5: 121,818,759 probably null Het
Slc22a18 G T 7: 143,490,820 C170F probably damaging Het
Slc24a1 G A 9: 64,947,927 T566I unknown Het
Slc4a5 T A 6: 83,260,535 C167S probably damaging Het
Slc8b1 T G 5: 120,533,035 V579G probably damaging Het
Snrnp200 T C 2: 127,221,902 V667A probably damaging Het
Sp8 C A 12: 118,849,335 S308R possibly damaging Het
Srsf9 T A 5: 115,330,560 V85E probably damaging Het
Syne1 T C 10: 5,218,527 I5285V probably benign Het
Tmem245 T C 4: 56,947,069 I115V probably benign Het
Triqk A G 4: 12,980,502 D82G probably benign Het
Trmt11 A T 10: 30,587,524 S198R probably damaging Het
Ube4b C T 4: 149,387,204 R75Q probably benign Het
Ugt3a1 C T 15: 9,310,693 Q354* probably null Het
Vmn1r202 A G 13: 22,501,680 V189A probably benign Het
Vmn2r26 A G 6: 124,039,647 I357V probably benign Het
Wdr6 T C 9: 108,573,748 K914R probably benign Het
Zfat T C 15: 68,258,686 M1V probably null Het
Zfp207 A G 11: 80,389,290 M171V probably benign Het
Zfp568 C T 7: 29,997,787 T44I probably damaging Het
Other mutations in Cd244
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Cd244 APN 1 171574370 critical splice donor site probably null
IGL01014:Cd244 APN 1 171574288 missense probably damaging 1.00
IGL01689:Cd244 APN 1 171582894 intron probably benign
IGL02327:Cd244 APN 1 171559341 missense probably benign 0.36
R0022:Cd244 UTSW 1 171573762 missense probably benign 0.03
R0930:Cd244 UTSW 1 171577233 splice site probably null
R1055:Cd244 UTSW 1 171577276 missense probably damaging 0.99
R4587:Cd244 UTSW 1 171577879 missense probably benign 0.05
R5517:Cd244 UTSW 1 171577974 splice site probably benign
R5929:Cd244 UTSW 1 171559367 missense probably damaging 1.00
R5996:Cd244 UTSW 1 171581640 splice site probably null
R6346:Cd244 UTSW 1 171577321 missense probably damaging 1.00
R6502:Cd244 UTSW 1 171577879 missense probably benign 0.05
R6612:Cd244 UTSW 1 171574104 missense probably benign 0.05
R6701:Cd244 UTSW 1 171574155 missense possibly damaging 0.67
R6973:Cd244 UTSW 1 171574207 missense probably damaging 1.00
R7655:Cd244 UTSW 1 171577255 missense probably damaging 1.00
R7656:Cd244 UTSW 1 171577255 missense probably damaging 1.00
R7769:Cd244 UTSW 1 171577305 missense probably benign 0.24
RF004:Cd244 UTSW 1 171577922 missense probably benign 0.15
Z1177:Cd244 UTSW 1 171574350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAGTAAGCAGCACCAGTC -3'
(R):5'- TCTCCCAGGAAAAGAAGATGCTG -3'

Sequencing Primer
(F):5'- AGTTTGTCACCCAACTGAGG -3'
(R):5'- CCAGGAAAAGAAGATGCTGTGTTTAG -3'
Posted On2019-11-12