Incidental Mutation 'R7672:Ube4b'
ID592217
Institutional Source Beutler Lab
Gene Symbol Ube4b
Ensembl Gene ENSMUSG00000028960
Gene Nameubiquitination factor E4B
SynonymsUFD2a, 4930551I19Rik, Ufd2p, 4933406G05Rik, UFD2, D4Bwg0973e
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7672 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location149328416-149426749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 149387204 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 75 (R75Q)
Ref Sequence ENSEMBL: ENSMUSP00000099501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103212] [ENSMUST00000172836] [ENSMUST00000174343]
PDB Structure
U-box domain of the E3 Ubiquitin Ligase E4B [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000103212
AA Change: R75Q

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099501
Gene: ENSMUSG00000028960
AA Change: R75Q

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
low complexity region 76 99 N/A INTRINSIC
low complexity region 261 278 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
Pfam:Ufd2P_core 462 1083 1.3e-199 PFAM
Ubox 1102 1164 3.94e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172836
AA Change: R75Q

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000134452
Gene: ENSMUSG00000028960
AA Change: R75Q

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
low complexity region 76 99 N/A INTRINSIC
low complexity region 261 278 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
Pfam:Ufd2P_core 462 983 7.4e-143 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174343
AA Change: R75Q

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134556
Gene: ENSMUSG00000028960
AA Change: R75Q

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
low complexity region 76 99 N/A INTRINSIC
low complexity region 261 278 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes an additional conjugation factor, E4, which is involved in multiubiquitin chain assembly. This gene is also the strongest candidate in the neuroblastoma tumor suppressor genes. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene die by midgestation and exhibit cardiac development defects such as hemorrhage and cardiomyocyte apoptosis. Heterozygous mice exhibit axonal dystrophy in the nucleus gracilis, degeneration of Purkinje cells and gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,237,019 H134R probably damaging Het
Adcy4 A G 14: 55,780,905 M195T probably benign Het
Aktip T C 8: 91,129,657 N64S possibly damaging Het
Aldoart1 C A 4: 72,852,510 M20I probably benign Het
Alms1 T C 6: 85,615,351 L395P probably damaging Het
Ankrd9 C A 12: 110,976,746 V252F probably benign Het
Apof A T 10: 128,269,016 H13L probably benign Het
Bahcc1 T C 11: 120,283,346 F1644S possibly damaging Het
Baz2a A G 10: 128,123,857 D1377G possibly damaging Het
Bbox1 T A 2: 110,305,449 I62F probably damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTG GTTCTGTGGTCACTGATTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTG 3: 95,888,143 probably benign Het
BC028528 TCTGTGGTCACTGGT TCTGTGGTCACTGGTGCTGTGGTCACTGGT 3: 95,888,175 probably benign Het
Bcas3 C T 11: 85,395,387 R124* probably null Het
Bpnt1 T C 1: 185,346,682 V114A probably damaging Het
Ccnd1 C T 7: 144,934,056 R228H possibly damaging Het
Cd244 T C 1: 171,577,285 V235A probably benign Het
Cramp1l C T 17: 24,982,466 E681K probably damaging Het
Crebbp C T 16: 4,084,710 A2222T probably benign Het
Cyp1a2 T A 9: 57,682,337 T65S probably benign Het
Cyp26b1 T G 6: 84,584,369 K104Q probably benign Het
D430041D05Rik T C 2: 104,241,236 I556V probably benign Het
Dnase1l2 A G 17: 24,442,245 L102P probably damaging Het
Elac1 C T 18: 73,738,854 G357S probably benign Het
Enam C A 5: 88,503,971 T1113N possibly damaging Het
Eogt A T 6: 97,113,909 I423N probably damaging Het
Epc2 T C 2: 49,545,819 S612P possibly damaging Het
Fam107b T C 2: 3,772,922 V24A probably damaging Het
Fam160b1 A G 19: 57,385,318 H670R possibly damaging Het
Foxj3 C T 4: 119,620,232 P413L unknown Het
Frg1 T C 8: 41,417,003 probably benign Het
Fsip2 T A 2: 82,990,111 V5396D possibly damaging Het
Gm49333 C A 16: 20,638,667 A483E probably damaging Het
Hdlbp T C 1: 93,437,099 T149A possibly damaging Het
Heatr1 A T 13: 12,438,664 Q2140L probably damaging Het
Iqcd T C 5: 120,606,816 L403P probably damaging Het
Kif1bp A G 10: 62,578,073 I102T probably benign Het
Kpna2 T G 11: 106,988,963 N505T probably benign Het
Lipo1 T A 19: 33,780,385 E228V probably benign Het
Map4k3 C T 17: 80,615,071 V474I possibly damaging Het
Mrpl11 T C 19: 4,962,396 S2P probably damaging Het
Mug2 A G 6: 122,040,719 I472V probably benign Het
Myom1 G A 17: 71,084,240 V915M possibly damaging Het
Nedd9 A T 13: 41,338,722 I104N possibly damaging Het
Nphp3 A G 9: 104,031,960 M790V probably benign Het
Nr3c2 C T 8: 76,909,209 P313L probably damaging Het
Obsl1 A G 1: 75,492,721 V1192A probably benign Het
Olfr1101 T C 2: 86,988,319 I286V possibly damaging Het
Olfr418 C T 1: 173,270,873 R233W probably benign Het
Olfr676 A G 7: 105,035,543 H115R probably damaging Het
Prr5l T G 2: 101,734,738 E151A probably damaging Het
Psmb8 G T 17: 34,198,430 R11L probably benign Het
Ptprg T A 14: 12,211,668 H983Q probably benign Het
Ptprj T C 2: 90,460,596 N600D possibly damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rc3h1 A G 1: 160,950,884 S460G probably damaging Het
Rhot2 A G 17: 25,843,105 probably null Het
Sall1 T C 8: 89,031,299 T726A probably damaging Het
Samd9l G A 6: 3,373,646 T1205I probably benign Het
Sh2b3 C T 5: 121,818,759 probably null Het
Slc22a18 G T 7: 143,490,820 C170F probably damaging Het
Slc24a1 G A 9: 64,947,927 T566I unknown Het
Slc4a5 T A 6: 83,260,535 C167S probably damaging Het
Slc8b1 T G 5: 120,533,035 V579G probably damaging Het
Snrnp200 T C 2: 127,221,902 V667A probably damaging Het
Sp8 C A 12: 118,849,335 S308R possibly damaging Het
Srsf9 T A 5: 115,330,560 V85E probably damaging Het
Syne1 T C 10: 5,218,527 I5285V probably benign Het
Tmem245 T C 4: 56,947,069 I115V probably benign Het
Triqk A G 4: 12,980,502 D82G probably benign Het
Trmt11 A T 10: 30,587,524 S198R probably damaging Het
Ugt3a1 C T 15: 9,310,693 Q354* probably null Het
Vmn1r202 A G 13: 22,501,680 V189A probably benign Het
Vmn2r26 A G 6: 124,039,647 I357V probably benign Het
Wdr6 T C 9: 108,573,748 K914R probably benign Het
Zfat T C 15: 68,258,686 M1V probably null Het
Zfp207 A G 11: 80,389,290 M171V probably benign Het
Zfp568 C T 7: 29,997,787 T44I probably damaging Het
Other mutations in Ube4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Ube4b APN 4 149381366 missense probably benign 0.29
IGL00820:Ube4b APN 4 149352921 splice site probably benign
IGL01093:Ube4b APN 4 149330269 missense probably benign 0.01
IGL01154:Ube4b APN 4 149365470 missense probably benign 0.28
IGL01612:Ube4b APN 4 149383818 missense probably damaging 0.98
IGL01800:Ube4b APN 4 149331494 missense probably damaging 1.00
IGL02149:Ube4b APN 4 149398684 missense possibly damaging 0.88
IGL02472:Ube4b APN 4 149387079 critical splice donor site probably null
IGL02839:Ube4b APN 4 149368399 missense probably damaging 0.98
IGL03027:Ube4b APN 4 149381277 missense probably damaging 1.00
R0143:Ube4b UTSW 4 149355457 missense possibly damaging 0.61
R0164:Ube4b UTSW 4 149360324 missense probably damaging 0.98
R0164:Ube4b UTSW 4 149360324 missense probably damaging 0.98
R0206:Ube4b UTSW 4 149398637 missense probably benign 0.38
R0591:Ube4b UTSW 4 149357577 intron probably benign
R1366:Ube4b UTSW 4 149335149 missense probably damaging 0.98
R1452:Ube4b UTSW 4 149371169 missense probably damaging 1.00
R1513:Ube4b UTSW 4 149351578 missense probably benign 0.17
R1668:Ube4b UTSW 4 149361294 missense probably benign 0.02
R1874:Ube4b UTSW 4 149347971 missense probably damaging 1.00
R2002:Ube4b UTSW 4 149383797 missense probably benign 0.16
R2050:Ube4b UTSW 4 149344612 missense probably damaging 1.00
R2109:Ube4b UTSW 4 149372841 missense probably benign 0.00
R2281:Ube4b UTSW 4 149344572 missense probably damaging 1.00
R3547:Ube4b UTSW 4 149335116 missense probably damaging 1.00
R3881:Ube4b UTSW 4 149365404 intron probably null
R4378:Ube4b UTSW 4 149383798 missense probably damaging 1.00
R4563:Ube4b UTSW 4 149359165 intron probably benign
R4674:Ube4b UTSW 4 149331370 missense possibly damaging 0.86
R4716:Ube4b UTSW 4 149344612 missense probably damaging 1.00
R5026:Ube4b UTSW 4 149360565 missense probably damaging 1.00
R5125:Ube4b UTSW 4 149342992 missense probably damaging 1.00
R5178:Ube4b UTSW 4 149342992 missense probably damaging 1.00
R5182:Ube4b UTSW 4 149381242 missense probably null 0.08
R5229:Ube4b UTSW 4 149387178 missense probably damaging 1.00
R5303:Ube4b UTSW 4 149383803 missense probably damaging 0.98
R5346:Ube4b UTSW 4 149337424 missense possibly damaging 0.91
R5780:Ube4b UTSW 4 149331364 missense probably benign 0.00
R5813:Ube4b UTSW 4 149337468 missense probably damaging 1.00
R5842:Ube4b UTSW 4 149331430 missense probably benign 0.01
R5994:Ube4b UTSW 4 149372932 missense probably damaging 0.97
R6020:Ube4b UTSW 4 149368311 missense probably benign 0.17
R6125:Ube4b UTSW 4 149398746 missense probably benign 0.13
R6272:Ube4b UTSW 4 149387133 missense probably damaging 1.00
R6333:Ube4b UTSW 4 149348037 missense probably damaging 1.00
R6426:Ube4b UTSW 4 149425996 unclassified probably benign
R7203:Ube4b UTSW 4 149398610 missense probably benign 0.30
R7341:Ube4b UTSW 4 149343001 missense probably damaging 1.00
R7713:Ube4b UTSW 4 149398781 missense possibly damaging 0.53
Z1088:Ube4b UTSW 4 149335125 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCTCTGGGTTACCACTTCAGAC -3'
(R):5'- TCGAGTGCTGACCTTAGGTG -3'

Sequencing Primer
(F):5'- TGGGTTACCACTTCAGACAGCTG -3'
(R):5'- CTGACCTTAGGTGATGCACAG -3'
Posted On2019-11-12