Incidental Mutation 'R7672:Enam'
ID592218
Institutional Source Beutler Lab
Gene Symbol Enam
Ensembl Gene ENSMUSG00000029286
Gene Nameenamelin
Synonymsabte
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.651) question?
Stock #R7672 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location88487975-88506049 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 88503971 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 1113 (T1113N)
Ref Sequence ENSEMBL: ENSMUSP00000142854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031222] [ENSMUST00000199104]
Predicted Effect probably damaging
Transcript: ENSMUST00000031222
AA Change: T1038N

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031222
Gene: ENSMUSG00000029286
AA Change: T1038N

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 67 114 N/A INTRINSIC
low complexity region 128 150 N/A INTRINSIC
low complexity region 159 167 N/A INTRINSIC
low complexity region 173 187 N/A INTRINSIC
low complexity region 203 214 N/A INTRINSIC
Pfam:Enamelin 216 441 5.4e-74 PFAM
Pfam:Enamelin 503 1249 1.9e-303 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199104
AA Change: T1113N

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142854
Gene: ENSMUSG00000029286
AA Change: T1113N

DomainStartEndE-ValueType
low complexity region 100 113 N/A INTRINSIC
low complexity region 142 189 N/A INTRINSIC
low complexity region 203 225 N/A INTRINSIC
low complexity region 234 242 N/A INTRINSIC
low complexity region 248 262 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
Pfam:Enamelin 291 510 2.5e-74 PFAM
Pfam:Enamelin 550 1325 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dental enamel forms the outer cap of teeth and is the hardest substance found in vertebrates. This gene encodes the largest protein in the enamel matrix of developing teeth. The protein is involved in the mineralization and structural organization of enamel. Defects in this gene result in amelogenesis imperfect type 1C.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice lack true enamel due to loss of mineralization at the secretory surface of ameloblasts and mandibular incisors are opaque with a rough surface and abnormal wear on the incisal edge. ENU-induced mutant mice provide models for various clinical subtypes of amelogenesis imperfecta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,237,019 H134R probably damaging Het
Adcy4 A G 14: 55,780,905 M195T probably benign Het
Aktip T C 8: 91,129,657 N64S possibly damaging Het
Aldoart1 C A 4: 72,852,510 M20I probably benign Het
Alms1 T C 6: 85,615,351 L395P probably damaging Het
Ankrd9 C A 12: 110,976,746 V252F probably benign Het
Apof A T 10: 128,269,016 H13L probably benign Het
Bahcc1 T C 11: 120,283,346 F1644S possibly damaging Het
Baz2a A G 10: 128,123,857 D1377G possibly damaging Het
Bbox1 T A 2: 110,305,449 I62F probably damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTG GTTCTGTGGTCACTGATTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTG 3: 95,888,143 probably benign Het
BC028528 TCTGTGGTCACTGGT TCTGTGGTCACTGGTGCTGTGGTCACTGGT 3: 95,888,175 probably benign Het
Bcas3 C T 11: 85,395,387 R124* probably null Het
Bpnt1 T C 1: 185,346,682 V114A probably damaging Het
Ccnd1 C T 7: 144,934,056 R228H possibly damaging Het
Cd244 T C 1: 171,577,285 V235A probably benign Het
Cramp1l C T 17: 24,982,466 E681K probably damaging Het
Crebbp C T 16: 4,084,710 A2222T probably benign Het
Cyp1a2 T A 9: 57,682,337 T65S probably benign Het
Cyp26b1 T G 6: 84,584,369 K104Q probably benign Het
D430041D05Rik T C 2: 104,241,236 I556V probably benign Het
Dnase1l2 A G 17: 24,442,245 L102P probably damaging Het
Elac1 C T 18: 73,738,854 G357S probably benign Het
Eogt A T 6: 97,113,909 I423N probably damaging Het
Epc2 T C 2: 49,545,819 S612P possibly damaging Het
Fam107b T C 2: 3,772,922 V24A probably damaging Het
Fam160b1 A G 19: 57,385,318 H670R possibly damaging Het
Foxj3 C T 4: 119,620,232 P413L unknown Het
Frg1 T C 8: 41,417,003 probably benign Het
Fsip2 T A 2: 82,990,111 V5396D possibly damaging Het
Gm49333 C A 16: 20,638,667 A483E probably damaging Het
Hdlbp T C 1: 93,437,099 T149A possibly damaging Het
Heatr1 A T 13: 12,438,664 Q2140L probably damaging Het
Iqcd T C 5: 120,606,816 L403P probably damaging Het
Kif1bp A G 10: 62,578,073 I102T probably benign Het
Kpna2 T G 11: 106,988,963 N505T probably benign Het
Lipo1 T A 19: 33,780,385 E228V probably benign Het
Map4k3 C T 17: 80,615,071 V474I possibly damaging Het
Mrpl11 T C 19: 4,962,396 S2P probably damaging Het
Mug2 A G 6: 122,040,719 I472V probably benign Het
Myom1 G A 17: 71,084,240 V915M possibly damaging Het
Nedd9 A T 13: 41,338,722 I104N possibly damaging Het
Nphp3 A G 9: 104,031,960 M790V probably benign Het
Nr3c2 C T 8: 76,909,209 P313L probably damaging Het
Obsl1 A G 1: 75,492,721 V1192A probably benign Het
Olfr1101 T C 2: 86,988,319 I286V possibly damaging Het
Olfr418 C T 1: 173,270,873 R233W probably benign Het
Olfr676 A G 7: 105,035,543 H115R probably damaging Het
Prr5l T G 2: 101,734,738 E151A probably damaging Het
Psmb8 G T 17: 34,198,430 R11L probably benign Het
Ptprg T A 14: 12,211,668 H983Q probably benign Het
Ptprj T C 2: 90,460,596 N600D possibly damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rc3h1 A G 1: 160,950,884 S460G probably damaging Het
Rhot2 A G 17: 25,843,105 probably null Het
Sall1 T C 8: 89,031,299 T726A probably damaging Het
Samd9l G A 6: 3,373,646 T1205I probably benign Het
Sh2b3 C T 5: 121,818,759 probably null Het
Slc22a18 G T 7: 143,490,820 C170F probably damaging Het
Slc24a1 G A 9: 64,947,927 T566I unknown Het
Slc4a5 T A 6: 83,260,535 C167S probably damaging Het
Slc8b1 T G 5: 120,533,035 V579G probably damaging Het
Snrnp200 T C 2: 127,221,902 V667A probably damaging Het
Sp8 C A 12: 118,849,335 S308R possibly damaging Het
Srsf9 T A 5: 115,330,560 V85E probably damaging Het
Syne1 T C 10: 5,218,527 I5285V probably benign Het
Tmem245 T C 4: 56,947,069 I115V probably benign Het
Triqk A G 4: 12,980,502 D82G probably benign Het
Trmt11 A T 10: 30,587,524 S198R probably damaging Het
Ube4b C T 4: 149,387,204 R75Q probably benign Het
Ugt3a1 C T 15: 9,310,693 Q354* probably null Het
Vmn1r202 A G 13: 22,501,680 V189A probably benign Het
Vmn2r26 A G 6: 124,039,647 I357V probably benign Het
Wdr6 T C 9: 108,573,748 K914R probably benign Het
Zfat T C 15: 68,258,686 M1V probably null Het
Zfp207 A G 11: 80,389,290 M171V probably benign Het
Zfp568 C T 7: 29,997,787 T44I probably damaging Het
Other mutations in Enam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Enam APN 5 88501484 missense possibly damaging 0.83
IGL01611:Enam APN 5 88503749 missense probably damaging 0.99
IGL01802:Enam APN 5 88503674 missense possibly damaging 0.93
IGL02220:Enam APN 5 88504559 nonsense probably null
IGL02371:Enam APN 5 88502809 missense probably benign 0.39
IGL02596:Enam APN 5 88503026 missense probably benign 0.01
IGL03026:Enam APN 5 88503299 missense probably benign 0.38
IGL03303:Enam APN 5 88504591 missense probably benign 0.12
opinionated UTSW 5 88503026 missense probably benign 0.04
recalcitrant UTSW 5 88503791 nonsense probably null
R0200:Enam UTSW 5 88493027 missense possibly damaging 0.96
R0230:Enam UTSW 5 88489655 splice site probably benign
R0395:Enam UTSW 5 88501508 missense probably damaging 0.99
R0548:Enam UTSW 5 88503105 missense probably damaging 0.96
R0608:Enam UTSW 5 88493027 missense possibly damaging 0.96
R0724:Enam UTSW 5 88501994 missense probably damaging 1.00
R0927:Enam UTSW 5 88494060 missense possibly damaging 0.72
R1023:Enam UTSW 5 88501967 missense probably damaging 0.99
R1053:Enam UTSW 5 88504019 missense possibly damaging 0.64
R1169:Enam UTSW 5 88503258 missense probably damaging 1.00
R1230:Enam UTSW 5 88494068 missense probably damaging 0.99
R1324:Enam UTSW 5 88494068 missense possibly damaging 0.53
R1663:Enam UTSW 5 88503994 missense probably damaging 1.00
R1727:Enam UTSW 5 88503994 missense probably damaging 1.00
R1750:Enam UTSW 5 88503227 missense probably damaging 1.00
R1852:Enam UTSW 5 88504465 missense possibly damaging 0.92
R1907:Enam UTSW 5 88504622 missense possibly damaging 0.86
R2104:Enam UTSW 5 88501787 missense probably damaging 1.00
R2143:Enam UTSW 5 88492920 missense probably benign 0.02
R2196:Enam UTSW 5 88502744 missense probably damaging 0.99
R2363:Enam UTSW 5 88503149 missense probably benign 0.24
R2497:Enam UTSW 5 88502694 missense probably benign 0.13
R3615:Enam UTSW 5 88504447 missense possibly damaging 0.81
R3616:Enam UTSW 5 88504447 missense possibly damaging 0.81
R3782:Enam UTSW 5 88502815 missense probably damaging 1.00
R4067:Enam UTSW 5 88503377 missense probably damaging 1.00
R4349:Enam UTSW 5 88503548 missense probably damaging 0.99
R4604:Enam UTSW 5 88504283 missense possibly damaging 0.93
R4649:Enam UTSW 5 88492968 missense probably benign 0.02
R4702:Enam UTSW 5 88503791 nonsense probably null
R4703:Enam UTSW 5 88503791 nonsense probably null
R4704:Enam UTSW 5 88503791 nonsense probably null
R4705:Enam UTSW 5 88503791 nonsense probably null
R4714:Enam UTSW 5 88503536 missense probably damaging 1.00
R4748:Enam UTSW 5 88501543 missense probably damaging 1.00
R4838:Enam UTSW 5 88493108 nonsense probably null
R4840:Enam UTSW 5 88503026 missense probably benign 0.04
R4856:Enam UTSW 5 88488734 nonsense probably null
R4886:Enam UTSW 5 88488734 nonsense probably null
R4910:Enam UTSW 5 88502314 missense probably benign
R4911:Enam UTSW 5 88502314 missense probably benign
R6103:Enam UTSW 5 88502328 missense probably damaging 0.96
R6651:Enam UTSW 5 88502917 missense probably damaging 0.98
R6759:Enam UTSW 5 88501691 missense probably damaging 1.00
R7282:Enam UTSW 5 88502327 missense probably damaging 0.99
R7365:Enam UTSW 5 88501488 missense possibly damaging 0.75
R7392:Enam UTSW 5 88501664 missense probably damaging 0.99
R7483:Enam UTSW 5 88501820 missense probably damaging 1.00
R7647:Enam UTSW 5 88503025 missense probably benign 0.00
R7648:Enam UTSW 5 88504157 missense possibly damaging 0.89
X0018:Enam UTSW 5 88502691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACAGTTGGCTTTCCCAGAC -3'
(R):5'- GAAAAGGCCACAATTCCTGTC -3'

Sequencing Primer
(F):5'- AGACTTCCTGCCTCAAAGTTAC -3'
(R):5'- AAGGCCACAATTCCTGTCTCTAG -3'
Posted On2019-11-12