Incidental Mutation 'RF027:Mn1'
ID604187
Institutional Source Beutler Lab
Gene Symbol Mn1
Ensembl Gene ENSMUSG00000070576
Gene Namemeningioma 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF027 (G1)
Quality Score181.47
Status Not validated
Chromosome5
Chromosomal Location111417362-111457033 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) CAG to CAGAAG at 111419705 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094463]
Predicted Effect probably benign
Transcript: ENSMUST00000094463
SMART Domains Protein: ENSMUSP00000092034
Gene: ENSMUSG00000070576

DomainStartEndE-ValueType
low complexity region 92 124 N/A INTRINSIC
low complexity region 128 144 N/A INTRINSIC
low complexity region 201 217 N/A INTRINSIC
low complexity region 291 303 N/A INTRINSIC
low complexity region 333 354 N/A INTRINSIC
coiled coil region 507 548 N/A INTRINSIC
low complexity region 551 565 N/A INTRINSIC
low complexity region 569 584 N/A INTRINSIC
low complexity region 643 657 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
low complexity region 708 725 N/A INTRINSIC
low complexity region 727 738 N/A INTRINSIC
low complexity region 745 771 N/A INTRINSIC
low complexity region 780 791 N/A INTRINSIC
low complexity region 862 892 N/A INTRINSIC
low complexity region 913 933 N/A INTRINSIC
low complexity region 957 972 N/A INTRINSIC
low complexity region 1098 1110 N/A INTRINSIC
low complexity region 1134 1145 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Meningioma 1 (MN1) contains two sets of CAG repeats. It is disrupted by a balanced translocation (4;22) in a meningioma, and its inactivation may contribute to meningioma 32 pathogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die shortly after birth due to cleft palate. Development of several bones in the skull was abnormal with completely absent alisphenoid, squamosal, and vomer bones, hypoplastic basisphenoid, pterygoid, and presphenoid bones, and thinfrontal, parietal, and interparietal bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik CTC CTCGTC 2: 130,770,744 probably benign Het
Blm CCTCCTCCTCCTC CCTCCTCCTCCTCTCCTCCTCCTC 7: 80,512,914 probably null Het
Cacna1f GAG GAGTAG X: 7,620,054 probably null Het
Ccdc170 ACC ACCTCC 10: 4,561,026 probably benign Het
Cul9 CTTC CTTCTTC 17: 46,500,848 probably benign Het
Cyb5r4 AGACACACTGCCCAGG AGACACACTGCCCAGGTATGTGACCGACACACTGCCCAGG 9: 87,040,431 probably benign Het
Dmkn GTGGA GTGGACGTGGTGGAAGTGGTGGAAGTGTTGGA 7: 30,767,194 probably benign Het
Dnah8 CCCTCCCG C 17: 30,635,476 probably null Het
Fam171b AGCAGC AGCAGCTGCAGC 2: 83,812,876 probably benign Het
Flywch1 TCACTCACCCACTCCTGGTGT TCACTCACCCACTCCTGGTGTGGGGAGGCTACGCACTCACCCACTCCTGGTGT 17: 23,762,158 probably null Het
Ifi208 AGATG AG 1: 173,677,696 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,068 probably null Het
Krtap28-10 CACAGC CACAGCCACAGCCACAACAGC 1: 83,042,285 probably benign Het
Lor ATAGCCG A 3: 92,081,876 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Med12l AGC AGCGGC 3: 59,275,967 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Mnd1 G A 3: 84,134,059 L79F possibly damaging Het
Nolc1 AGCAGCAGC AGCAGCAGCGGCAGCAGC 19: 46,081,363 probably benign Het
Papd7 GACA G 13: 69,533,854 probably benign Het
Pdcd11 GGAGGAG GG 19: 47,113,449 probably null Het
Rbfox2 G T 15: 77,132,773 Q134K possibly damaging Het
Tcof1 AGC AGCTGC 18: 60,835,736 probably benign Het
Ttf2 TTCT TTCTTCT 3: 100,963,157 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Vmn2r58 CAAAATGATGTAGCACTT C 7: 41,836,959 probably null Het
Zfhx3 CAGCAGCA CAGCAGCAAGAGCAGCA 8: 108,956,098 probably benign Het
Zfp384 CCCAGGC CCCAGGCCCAGGACCAGGC 6: 125,036,490 probably benign Het
Other mutations in Mn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Mn1 APN 5 111421547 missense possibly damaging 0.85
IGL01139:Mn1 APN 5 111421449 missense probably damaging 0.96
IGL01546:Mn1 APN 5 111421248 missense probably damaging 1.00
IGL02252:Mn1 APN 5 111421241 missense probably damaging 0.96
IGL02821:Mn1 APN 5 111421851 missense probably damaging 0.99
IGL03203:Mn1 APN 5 111421403 missense probably benign
Uebermus UTSW 5 111421886 splice site probably null
FR4342:Mn1 UTSW 5 111419706 small insertion probably benign
FR4449:Mn1 UTSW 5 111419710 small insertion probably benign
FR4548:Mn1 UTSW 5 111419698 small insertion probably benign
FR4976:Mn1 UTSW 5 111419702 small insertion probably benign
R0639:Mn1 UTSW 5 111419316 missense probably damaging 1.00
R0676:Mn1 UTSW 5 111421034 missense possibly damaging 0.52
R1537:Mn1 UTSW 5 111454780 missense probably damaging 0.96
R1638:Mn1 UTSW 5 111421569 missense probably damaging 1.00
R1739:Mn1 UTSW 5 111420014 missense possibly damaging 0.92
R1922:Mn1 UTSW 5 111418746 missense probably damaging 0.99
R2008:Mn1 UTSW 5 111418857 missense probably damaging 1.00
R2104:Mn1 UTSW 5 111454751 missense possibly damaging 0.72
R2519:Mn1 UTSW 5 111418552 missense possibly damaging 0.85
R3980:Mn1 UTSW 5 111421770 missense possibly damaging 0.85
R4008:Mn1 UTSW 5 111420169 missense probably benign
R4564:Mn1 UTSW 5 111420667 missense possibly damaging 0.93
R4647:Mn1 UTSW 5 111420083 missense probably benign
R4779:Mn1 UTSW 5 111419660 missense probably damaging 0.99
R4819:Mn1 UTSW 5 111419937 missense possibly damaging 0.93
R4962:Mn1 UTSW 5 111454786 missense possibly damaging 0.85
R5373:Mn1 UTSW 5 111421886 splice site probably null
R5374:Mn1 UTSW 5 111421886 splice site probably null
R5521:Mn1 UTSW 5 111421769 missense possibly damaging 0.72
R5633:Mn1 UTSW 5 111420326 missense possibly damaging 0.52
R5744:Mn1 UTSW 5 111420536 missense possibly damaging 0.93
R6050:Mn1 UTSW 5 111419397 missense probably damaging 1.00
R6552:Mn1 UTSW 5 111420887 missense possibly damaging 0.93
R7206:Mn1 UTSW 5 111420512 missense possibly damaging 0.85
R7244:Mn1 UTSW 5 111418833 missense possibly damaging 0.78
RF025:Mn1 UTSW 5 111419705 nonsense probably null
RF028:Mn1 UTSW 5 111419711 small insertion probably benign
RF032:Mn1 UTSW 5 111419711 small insertion probably benign
RF040:Mn1 UTSW 5 111419705 small insertion probably benign
Z1088:Mn1 UTSW 5 111418280 missense possibly damaging 0.85
Z1176:Mn1 UTSW 5 111420379 missense probably benign 0.08
Z1176:Mn1 UTSW 5 111454706 missense possibly damaging 0.93
Z1177:Mn1 UTSW 5 111420068 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTGACTTTCCGGGCAGC -3'
(R):5'- AAAGTTCGTCTGGGCCAAG -3'

Sequencing Primer
(F):5'- GCAGCATGCATAACGGTA -3'
(R):5'- AACCTCCGTGGACCAGG -3'
Posted On2019-12-04