Incidental Mutation 'RF045:Lce1m'
ID604991
Institutional Source Beutler Lab
Gene Symbol Lce1m
Ensembl Gene ENSMUSG00000027912
Gene Namelate cornified envelope 1M
SynonymsSprrl10, Lce5a, 1110059L13Rik
Accession Numbers
Is this an essential gene? Not available question?
Stock #RF045 (G1)
Quality Score217.468
Status Not validated
Chromosome3
Chromosomal Location93017810-93019060 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) TGCTGCC to TGCTGCCCCCGCCGCTGCC at 93018292 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029520] [ENSMUST00000029521] [ENSMUST00000107301] [ENSMUST00000193944]
Predicted Effect probably benign
Transcript: ENSMUST00000029520
SMART Domains Protein: ENSMUSP00000029520
Gene: ENSMUSG00000027912

DomainStartEndE-ValueType
Pfam:LCE 9 96 5.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029521
SMART Domains Protein: ENSMUSP00000029521
Gene: ENSMUSG00000027913

DomainStartEndE-ValueType
low complexity region 12 102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107301
SMART Domains Protein: ENSMUSP00000102922
Gene: ENSMUSG00000027913

DomainStartEndE-ValueType
Pfam:NICE-1 5 100 5.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193944
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik TTCTGTA T 1: 43,737,192 probably benign Het
AI837181 GCG GCGCCG 19: 5,425,218 probably benign Het
Arid1b CGGGGG CGGGGGGGG 17: 4,995,583 probably benign Het
Cdsn CAGC CAGCAGCTCTCAGTCAGGAAGTAGC 17: 35,554,968 probably benign Het
Cyb5r4 ATGT ATGTGAGACACACTGCCCAGGGATGTGT 9: 87,040,402 probably null Het
Cyb5r4 GA GATGTGACAGACACACTGCCCAGGAA 9: 87,040,447 probably benign Het
Cyp4a12b C T 4: 115,432,493 H186Y probably benign Het
Dbr1 AAGAGGA AAGAGGAAGAGGA 9: 99,583,671 probably benign Het
Dnmt1 ACAGTTCCTACCTCGTT ACAGTTCCTACCTCGTTTTGGGCGCGGAGCCCAGTTCCTACCTCGTT 9: 20,910,129 probably null Het
Dnmt1 TACCTCGTT TACCTCGTTTTGGGGGCGGAGCACAGTTCCCACCTCGTT 9: 20,910,137 probably benign Het
Fam71e1 GGAGGA GGAGGAAGGCTGGATCCTGGATACCTGGGTCTGAGTGAGGA 7: 44,500,532 probably null Het
Gabre CTCAGGCT C X: 72,270,181 probably null Het
Gabre CCGGCT CCGGCTGCGGCT X: 72,270,045 probably benign Het
Iqcf4 TTCCTTTTCCTTTT TTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTATCCTTTTCCTTTT 9: 106,570,610 probably benign Het
Kcnq3 CCGCCAGCCGC CC 15: 66,286,184 probably benign Het
Krtap28-10 CCACAG CCACAGTCACAG 1: 83,042,143 probably benign Het
Krtap28-10 CACAGCCACCACAGCCACAGCCACCACAGC CACAGCCACCACAGCAACAGCCACCACAGCCACAGCCACCACAGC 1: 83,042,261 probably benign Het
Map1a CAGCTCCAGCTCCAGCTCC CAGCTCCAGCTCCAGCTCCCGCTCCAGCTCTAGCTCCAGCTCCAGCTCC 2: 121,306,293 probably benign Het
Ncapd2 ACT ACTACACGCCGTCAGAGCACCGTGTTCTGTCACATCCT 6: 125,179,236 probably null Het
Neu1 TCTTCTA T 17: 34,932,558 probably benign Het
Ntn4 G T 10: 93,710,625 R380L possibly damaging Het
Nusap1 A ATACACGTTAGCAGTGAGGAGCAAGCTGAGG 2: 119,627,610 probably benign Het
Plxnc1 C T 10: 94,865,007 C605Y probably damaging Het
Ptms CTCCTC CTCCTCCTC 6: 124,914,450 probably benign Het
Snx1 CTGTT CTGTTGTT 9: 66,104,922 probably benign Het
Strn CCCAGTC CCCAGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACACCAGTC 17: 78,677,282 probably null Het
Supt20 GCAGCA GCAGCATCAGCA 3: 54,727,666 probably benign Het
Other mutations in Lce1m
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4342:Lce1m UTSW 3 93018247 unclassified probably benign
FR4449:Lce1m UTSW 3 93018152 unclassified probably benign
FR4589:Lce1m UTSW 3 93018268 unclassified probably benign
FR4976:Lce1m UTSW 3 93018148 unclassified probably benign
R1513:Lce1m UTSW 3 93018625 unclassified probably benign
R7621:Lce1m UTSW 3 93017870 splice site probably null
R7753:Lce1m UTSW 3 93018508 missense unknown
RF001:Lce1m UTSW 3 93018152 unclassified probably benign
RF001:Lce1m UTSW 3 93018269 unclassified probably benign
RF002:Lce1m UTSW 3 93018283 unclassified probably benign
RF002:Lce1m UTSW 3 93018299 unclassified probably benign
RF007:Lce1m UTSW 3 93018144 unclassified probably benign
RF009:Lce1m UTSW 3 93018131 unclassified probably benign
RF010:Lce1m UTSW 3 93018290 unclassified probably benign
RF015:Lce1m UTSW 3 93018148 unclassified probably benign
RF021:Lce1m UTSW 3 93018269 unclassified probably benign
RF021:Lce1m UTSW 3 93018295 unclassified probably benign
RF023:Lce1m UTSW 3 93018280 unclassified probably benign
RF026:Lce1m UTSW 3 93018138 unclassified probably benign
RF026:Lce1m UTSW 3 93018143 unclassified probably benign
RF028:Lce1m UTSW 3 93018131 unclassified probably benign
RF030:Lce1m UTSW 3 93018141 unclassified probably benign
RF030:Lce1m UTSW 3 93018344 unclassified probably benign
RF037:Lce1m UTSW 3 93018300 unclassified probably benign
RF041:Lce1m UTSW 3 93018141 unclassified probably benign
RF042:Lce1m UTSW 3 93018139 unclassified probably benign
RF046:Lce1m UTSW 3 93018293 unclassified probably benign
RF054:Lce1m UTSW 3 93018298 unclassified probably benign
RF059:Lce1m UTSW 3 93018329 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATGTTCTTCGTGGCCAGGTC -3'
(R):5'- AGATGTCCTGTCAGCAGAGC -3'

Sequencing Primer
(F):5'- GGTCAGCAGCAACCTCCAGAG -3'
(R):5'- GCTGTCTGAGCCACCACAAG -3'
Posted On2019-12-04