Incidental Mutation 'R7901:Ifi213'
ID609972
Institutional Source Beutler Lab
Gene Symbol Ifi213
Ensembl Gene ENSMUSG00000073491
Gene Nameinterferon activated gene 213
SynonymsE030037K03Rik, Pydc4, Pyr-A
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7901 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location173566283-173599274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 173567218 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 584 (S584T)
Ref Sequence ENSEMBL: ENSMUSP00000117222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000150649]
Predicted Effect probably benign
Transcript: ENSMUST00000150649
AA Change: S584T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000117222
Gene: ENSMUSG00000073491
AA Change: S584T

DomainStartEndE-ValueType
PYRIN 10 88 3.71e-20 SMART
low complexity region 101 112 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,269,706 E3126G unknown Het
Ablim1 A T 19: 57,131,002 probably null Het
Adpgk T C 9: 59,315,017 V409A probably benign Het
Agfg2 A T 5: 137,667,704 F98I probably damaging Het
Arhgap17 A T 7: 123,286,568 probably benign Het
Asb8 T C 15: 98,142,733 Y16C probably damaging Het
Atp6v0a2 C T 5: 124,641,547 T200I probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccnt1 A T 15: 98,543,916 D490E probably benign Het
Cenpf G T 1: 189,657,248 D1462E probably damaging Het
Clcn6 C T 4: 148,010,745 R736H probably damaging Het
Col4a2 A T 8: 11,429,358 D747V probably benign Het
Crybg3 T C 16: 59,557,544 T1116A probably damaging Het
Csf1r T A 18: 61,110,296 L128Q probably damaging Het
Ddx17 A T 15: 79,538,588 D316E probably damaging Het
Ect2l T A 10: 18,141,964 D681V possibly damaging Het
Ell2 A T 13: 75,763,986 K464* probably null Het
Eme1 G T 11: 94,650,819 P59Q probably damaging Het
Etl4 T C 2: 20,290,010 S2P possibly damaging Het
Fndc9 T C 11: 46,237,749 Y32H probably damaging Het
Frem1 G T 4: 82,959,377 T1321K probably benign Het
Gabrg2 A G 11: 41,976,591 V67A probably benign Het
Gm4553 ACAGCAGCTGGACTGACAGCAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAG ACAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAG 7: 142,164,865 probably benign Het
Gm5145 A C 17: 20,570,638 I93L possibly damaging Het
Gpld1 T A 13: 24,962,775 V240E probably damaging Het
Gsc T A 12: 104,472,872 S82C possibly damaging Het
H2-T10 C T 17: 36,120,251 E173K probably benign Het
Klk1b1 T C 7: 43,971,245 I253T probably damaging Het
Klra4 A G 6: 130,063,150 L53P probably damaging Het
Lct A G 1: 128,288,985 Y1697H probably benign Het
Mrs2 T A 13: 25,018,566 D64V possibly damaging Het
Muc13 A G 16: 33,815,841 Q565R probably damaging Het
Nlrp6 T C 7: 140,927,440 V873A possibly damaging Het
Nup155 C T 15: 8,116,442 P159L possibly damaging Het
Olfr1420 A T 19: 11,896,534 H171L probably benign Het
Olfr575 T C 7: 102,955,680 probably null Het
Olfr734 A T 14: 50,320,116 S240T probably damaging Het
Phip T G 9: 82,890,150 M1115L probably benign Het
Ppip5k1 T C 2: 121,311,909 Q1353R probably damaging Het
Ptprb C G 10: 116,369,428 P1896A probably benign Het
Rgl2 T C 17: 33,935,825 L601P possibly damaging Het
Sash1 C T 10: 8,780,564 W221* probably null Het
Skint1 A C 4: 112,019,202 T107P probably damaging Het
Slc45a4 G A 15: 73,605,772 probably benign Het
Snx13 T A 12: 35,100,625 D309E probably benign Het
Spcs1 A G 14: 31,000,671 Y64H probably benign Het
Tep1 A T 14: 50,826,851 Y2434N possibly damaging Het
Tnpo3 T C 6: 29,568,991 E454G possibly damaging Het
Tsg101 G T 7: 46,913,435 Q24K probably benign Het
Ttc6 C T 12: 57,688,567 R1132W probably damaging Het
Unkl T C 17: 25,218,653 S200P probably damaging Het
Uts2r G A 11: 121,161,408 S366N probably benign Het
Wbp4 A T 14: 79,472,405 V130E probably damaging Het
Zfp592 T G 7: 81,024,721 S478A probably benign Het
Zfp664 A T 5: 124,885,775 K78* probably null Het
Zfp738 A T 13: 67,672,991 L79* probably null Het
Zfyve28 C T 5: 34,224,982 R258Q probably damaging Het
Other mutations in Ifi213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Ifi213 APN 1 173594053 splice site probably benign
IGL00908:Ifi213 APN 1 173595083 missense probably damaging 1.00
IGL00964:Ifi213 APN 1 173593952 missense possibly damaging 0.91
IGL02217:Ifi213 APN 1 173595032 missense possibly damaging 0.91
R0709:Ifi213 UTSW 1 173589800 missense possibly damaging 0.70
R1518:Ifi213 UTSW 1 173589663 missense probably damaging 0.99
R1559:Ifi213 UTSW 1 173567218 missense probably benign 0.18
R1822:Ifi213 UTSW 1 173589842 missense probably damaging 0.99
R1839:Ifi213 UTSW 1 173589600 missense probably damaging 0.98
R1989:Ifi213 UTSW 1 173568808 critical splice donor site probably null
R2108:Ifi213 UTSW 1 173569102 critical splice acceptor site probably null
R2696:Ifi213 UTSW 1 173590024 missense probably benign
R3890:Ifi213 UTSW 1 173567256 missense probably benign 0.33
R4544:Ifi213 UTSW 1 173582127 splice site probably null
R4611:Ifi213 UTSW 1 173589914 missense possibly damaging 0.91
R4689:Ifi213 UTSW 1 173590420 missense possibly damaging 0.92
R4710:Ifi213 UTSW 1 173567172 utr 3 prime probably benign
R5126:Ifi213 UTSW 1 173590015 missense possibly damaging 0.85
R5472:Ifi213 UTSW 1 173567272 splice site probably null
R5625:Ifi213 UTSW 1 173569063 missense possibly damaging 0.73
R5789:Ifi213 UTSW 1 173568794 splice site probably benign
R5898:Ifi213 UTSW 1 173568979 missense probably benign 0.01
R6025:Ifi213 UTSW 1 173595234 missense probably damaging 0.99
R6149:Ifi213 UTSW 1 173594015 missense probably benign 0.18
R6348:Ifi213 UTSW 1 173590282 missense possibly damaging 0.46
R6564:Ifi213 UTSW 1 173595296 start codon destroyed probably null 0.06
R7254:Ifi213 UTSW 1 173593963 missense probably damaging 0.98
R7292:Ifi213 UTSW 1 173595125 missense probably damaging 0.99
R7752:Ifi213 UTSW 1 173567218 missense probably benign 0.18
R8100:Ifi213 UTSW 1 173595182 missense probably damaging 1.00
R8352:Ifi213 UTSW 1 173595269 missense possibly damaging 0.92
R8425:Ifi213 UTSW 1 173589860 missense probably benign
R8452:Ifi213 UTSW 1 173595269 missense possibly damaging 0.92
RF010:Ifi213 UTSW 1 173582153 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGAAATTCCAAGCCCAGGGTC -3'
(R):5'- GTCATGCCATTACCTTATAATGCAAC -3'

Sequencing Primer
(F):5'- CTCCAGGACTGCCTAGGATATTG -3'
(R):5'- GCCATTACCTTATAATGCAACCATTG -3'
Posted On2019-12-20