Incidental Mutation 'R7911:Farp1'
ID610535
Institutional Source Beutler Lab
Gene Symbol Farp1
Ensembl Gene ENSMUSG00000025555
Gene NameFERM, RhoGEF (Arhgef) and pleckstrin domain protein 1 (chondrocyte-derived)
SynonymsCdep
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7911 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location121035200-121283744 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121242406 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 370 (S370P)
Ref Sequence ENSEMBL: ENSMUSP00000026635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026635]
Predicted Effect probably damaging
Transcript: ENSMUST00000026635
AA Change: S370P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026635
Gene: ENSMUSG00000025555
AA Change: S370P

DomainStartEndE-ValueType
B41 36 230 3.27e-68 SMART
FERM_C 234 324 3.87e-32 SMART
FA 328 374 6.07e-16 SMART
RhoGEF 546 732 2.07e-47 SMART
PH 763 861 1.05e-16 SMART
PH 936 1034 1.55e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a FERM (4.2, exrin, radixin, moesin) domain, a Dbl homology domain, and two pleckstrin homology domains. These domains are found in guanine nucleotide exchange factors and proteins that link the cytoskeleton to the cell membrane. The encoded protein functions in neurons to promote dendritic growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T A 5: 98,737,708 M158K possibly damaging Het
1700028K03Rik T C 5: 107,545,801 F95L probably benign Het
Abca3 C G 17: 24,398,504 D1058E probably damaging Het
Abca7 C A 10: 80,005,033 R919S probably benign Het
Abcc2 T C 19: 43,803,670 S297P probably benign Het
Abcc8 A G 7: 46,154,436 L438P probably damaging Het
Acbd6 C A 1: 155,687,004 D250E probably damaging Het
Ankrd31 A G 13: 96,879,100 N1626D possibly damaging Het
Arrdc4 C T 7: 68,745,176 E112K probably benign Het
B3galnt1 T A 3: 69,575,241 Y229F probably damaging Het
Calcrl A C 2: 84,351,231 I191S probably damaging Het
Camkmt T A 17: 85,452,438 probably null Het
Card11 A G 5: 140,882,000 probably null Het
Cfap157 A G 2: 32,778,207 L407P probably damaging Het
Chst15 T C 7: 132,270,522 Q10R probably benign Het
Col26a1 A G 5: 136,743,098 L424P probably damaging Het
Cryzl2 T C 1: 157,472,355 M308T probably benign Het
Ctu2 T C 8: 122,480,994 I403T probably benign Het
D1Ertd622e T A 1: 97,645,890 H150L probably damaging Het
Ddhd2 A G 8: 25,748,536 probably null Het
Dmrt1 T A 19: 25,603,328 L368Q probably benign Het
Dnah7b C A 1: 46,139,678 P837Q probably damaging Het
Drg2 T A 11: 60,464,175 L283Q possibly damaging Het
Dscam G A 16: 96,643,922 T1523I probably benign Het
Fbxl21 G A 13: 56,537,163 G360D probably damaging Het
Fbxo39 T C 11: 72,317,532 S237P probably damaging Het
Gart G T 16: 91,638,784 F180L probably benign Het
Gng4 T C 13: 13,825,272 L42P possibly damaging Het
Heatr9 T A 11: 83,512,408 D435V probably damaging Het
Hsh2d A G 8: 72,196,804 E45G probably damaging Het
Ighv1-74 A G 12: 115,802,790 I70T probably damaging Het
Igkv1-133 T A 6: 67,724,940 F9L probably benign Het
Ipo5 A G 14: 120,929,639 probably null Het
Jmjd1c T C 10: 67,231,995 V1578A probably damaging Het
Kcnj5 T C 9: 32,322,221 D266G probably damaging Het
Klk1b9 A T 7: 43,979,787 K206N probably damaging Het
Madd C T 2: 91,167,508 G725D probably null Het
Mki67 A T 7: 135,704,604 H576Q probably damaging Het
Mprip T A 11: 59,760,855 I36N Het
Mycbp2 T G 14: 103,200,185 E2113D probably damaging Het
Narfl A G 17: 25,780,398 E262G probably benign Het
Noa1 T C 5: 77,309,830 Y76C probably damaging Het
Noct A G 3: 51,247,648 probably benign Het
Olfr205 C T 16: 59,329,243 D89N possibly damaging Het
Pcdhga6 C T 18: 37,709,426 S733L not run Het
Pdlim7 T C 13: 55,499,106 E389G probably damaging Het
Ppip5k1 A G 2: 121,342,658 Y480H possibly damaging Het
Prc1 T A 7: 80,304,372 D93E probably benign Het
Prdm15 A G 16: 97,812,592 M459T probably benign Het
Ptpn13 G A 5: 103,541,058 A906T probably damaging Het
Ptpn21 T C 12: 98,688,842 E622G probably damaging Het
Pum1 T C 4: 130,774,477 V1104A probably benign Het
Scn2a G A 2: 65,682,083 R188Q probably null Het
Sh3pxd2b G A 11: 32,371,533 V31I probably damaging Het
Skor1 T C 9: 63,145,046 E547G possibly damaging Het
Slk C T 19: 47,615,229 T183I Het
Sorcs1 C A 19: 50,144,032 D1163Y unknown Het
Tex14 G A 11: 87,533,602 probably null Het
Them5 A G 3: 94,346,189 T169A possibly damaging Het
Tmem56 A T 3: 121,228,392 I119K probably damaging Het
Trav5-4 T C 14: 53,704,451 F94L probably benign Het
Trpc6 G C 9: 8,656,704 G789R probably benign Het
Ttn A T 2: 76,706,751 C34944* probably null Het
Usp53 T C 3: 122,961,267 M180V probably benign Het
Vwa3b T C 1: 37,154,026 S8P probably damaging Het
Wdr90 A T 17: 25,850,749 M1205K probably benign Het
Zcwpw1 A T 5: 137,796,770 E76V probably null Het
Other mutations in Farp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Farp1 APN 14 121237149 missense probably damaging 1.00
IGL01017:Farp1 APN 14 121272774 missense possibly damaging 0.64
IGL02309:Farp1 APN 14 121243516 missense probably benign
IGL02376:Farp1 APN 14 121272856 missense probably damaging 0.98
IGL03018:Farp1 APN 14 121102169 missense probably benign
IGL03400:Farp1 APN 14 121207321 missense probably damaging 1.00
R0034:Farp1 UTSW 14 121255429 missense probably benign 0.00
R0046:Farp1 UTSW 14 121255513 missense probably benign 0.00
R0046:Farp1 UTSW 14 121255513 missense probably benign 0.00
R0219:Farp1 UTSW 14 121243600 missense possibly damaging 0.88
R0359:Farp1 UTSW 14 121255396 splice site probably benign
R0616:Farp1 UTSW 14 121277022 missense probably damaging 1.00
R0653:Farp1 UTSW 14 121233846 critical splice donor site probably null
R0710:Farp1 UTSW 14 121237143 missense probably damaging 1.00
R1391:Farp1 UTSW 14 121257966 nonsense probably null
R1791:Farp1 UTSW 14 121256745 missense probably damaging 1.00
R1920:Farp1 UTSW 14 121255496 missense probably benign 0.16
R1953:Farp1 UTSW 14 121255482 missense probably benign
R1958:Farp1 UTSW 14 121219375 critical splice acceptor site probably null
R2891:Farp1 UTSW 14 121256736 missense probably damaging 1.00
R3121:Farp1 UTSW 14 121222726 splice site probably benign
R4005:Farp1 UTSW 14 121276397 missense probably damaging 0.99
R4257:Farp1 UTSW 14 121255479 missense probably benign 0.00
R4559:Farp1 UTSW 14 121272801 missense probably damaging 1.00
R4654:Farp1 UTSW 14 121276304 missense possibly damaging 0.50
R4739:Farp1 UTSW 14 121238787 missense probably damaging 1.00
R4831:Farp1 UTSW 14 121277057 missense probably damaging 1.00
R4988:Farp1 UTSW 14 121275607 missense probably damaging 1.00
R5379:Farp1 UTSW 14 121256757 missense possibly damaging 0.88
R5463:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5466:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5467:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5511:Farp1 UTSW 14 121237172 missense probably damaging 0.98
R5520:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5635:Farp1 UTSW 14 121276304 missense possibly damaging 0.96
R5639:Farp1 UTSW 14 121275382 missense probably damaging 1.00
R5954:Farp1 UTSW 14 121222667 missense probably damaging 0.99
R6765:Farp1 UTSW 14 121222654 missense probably benign 0.00
R7469:Farp1 UTSW 14 121275421 missense probably damaging 1.00
R7549:Farp1 UTSW 14 121235177 missense possibly damaging 0.89
R7660:Farp1 UTSW 14 121276922 missense probably benign 0.00
R7752:Farp1 UTSW 14 121257947 missense probably damaging 1.00
R7788:Farp1 UTSW 14 121276253 missense probably benign 0.12
R8013:Farp1 UTSW 14 121242401 missense probably damaging 1.00
R8078:Farp1 UTSW 14 121276300 missense probably benign 0.04
R8113:Farp1 UTSW 14 121275596 missense probably benign 0.35
R8116:Farp1 UTSW 14 121233820 missense probably damaging 1.00
R8716:Farp1 UTSW 14 121242443 missense probably benign
RF024:Farp1 UTSW 14 121237148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTTTCCACACCGGCATTTAG -3'
(R):5'- GACTGCCATGTATGCTTCAATCC -3'

Sequencing Primer
(F):5'- CCACACCGGCATTTAGAAAATATTG -3'
(R):5'- TTCAATCCCCAGACTCATGAGGTG -3'
Posted On2019-12-20