Incidental Mutation 'R7995:Mlh1'
ID616039
Institutional Source Beutler Lab
Gene Symbol Mlh1
Ensembl Gene ENSMUSG00000032498
Gene NamemutL homolog 1
Synonymscolon cancer, nonpolyposis type 2, 1110035C23Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7995 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location111228228-111271791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 111235921 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 555 (N555K)
Ref Sequence ENSEMBL: ENSMUSP00000035079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035079] [ENSMUST00000135218]
Predicted Effect probably damaging
Transcript: ENSMUST00000035079
AA Change: N555K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035079
Gene: ENSMUSG00000032498
AA Change: N555K

DomainStartEndE-ValueType
HATPase_c 23 158 4.57e-1 SMART
DNA_mis_repair 216 335 1.08e-44 SMART
low complexity region 363 375 N/A INTRINSIC
low complexity region 429 454 N/A INTRINSIC
Pfam:Mlh1_C 504 760 8.3e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135218
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). It is a human homolog of the E. coli DNA mismatch repair gene mutL, consistent with the characteristic alterations in microsatellite sequences (RER+phenotype) found in HNPCC. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described, but their full-length natures have not been determined.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced pairing in meiotic prophase I and produce no mature germ cells. Mutants also display increased microsatellite instability and a predisposition for developing intestinal and other tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,556,879 T137S unknown Het
Apbb1 T C 7: 105,565,645 D462G probably benign Het
Arhgef1 T G 7: 24,919,216 L387R probably damaging Het
Ass1 A G 2: 31,486,540 I139V probably benign Het
B4galt5 A G 2: 167,301,376 V376A probably damaging Het
Bdkrb1 A G 12: 105,605,120 N315S probably damaging Het
Brap A T 5: 121,682,846 I429L probably benign Het
Capn2 A G 1: 182,478,546 probably null Het
Car10 A G 11: 93,597,122 Y215C probably damaging Het
Ccdc102a T C 8: 94,907,867 T365A probably damaging Het
Cdc42ep1 A G 15: 78,847,496 H47R probably damaging Het
Celsr3 G A 9: 108,845,083 S2734N probably damaging Het
Cers5 A C 15: 99,740,942 probably null Het
Cfap43 T C 19: 47,898,023 E51G probably damaging Het
Cftr T A 6: 18,214,156 D110E probably damaging Het
Cntnap5a A G 1: 116,571,547 K1176E probably damaging Het
Dlx6 A T 6: 6,867,277 R293S probably damaging Het
Dnah2 A T 11: 69,520,737 F353Y possibly damaging Het
Dnajc13 A T 9: 104,174,363 I1765N probably damaging Het
Ercc6 G T 14: 32,562,569 R763L probably damaging Het
Furin T C 7: 80,395,447 N243S probably damaging Het
Gm13083 A G 4: 143,616,000 I226V possibly damaging Het
Hace1 A G 10: 45,589,492 E48G probably damaging Het
Kcnv1 G A 15: 45,109,347 T380I probably damaging Het
Klk4 T A 7: 43,883,586 I32N probably damaging Het
Lexm T A 4: 106,615,915 H57L probably benign Het
Lingo2 T C 4: 35,709,425 E185G probably damaging Het
Lrba T A 3: 86,619,551 W2239R probably damaging Het
Micalcl T A 7: 112,381,768 D316E probably benign Het
Mroh2b G A 15: 4,921,357 W579* probably null Het
Mycs G A X: 5,468,804 P74L probably damaging Het
Olfr486 A T 7: 108,172,000 L248H probably damaging Het
Olfr802 T C 10: 129,682,640 Y33C probably damaging Het
Pak2 T C 16: 32,027,772 I365V possibly damaging Het
Pcdhga11 C A 18: 37,757,025 S362* probably null Het
Pdk4 C T 6: 5,487,093 V318M probably benign Het
Phc2 C T 4: 128,709,608 T177M probably damaging Het
Phldb1 A T 9: 44,715,372 L592Q probably damaging Het
Pigr A G 1: 130,841,686 Y78C probably damaging Het
Pnkp T A 7: 44,858,536 Y94* probably null Het
Polr2b T C 5: 77,325,767 V310A possibly damaging Het
Prl7d1 T A 13: 27,710,071 I171L probably benign Het
Rpusd4 A G 9: 35,272,721 Y224C probably damaging Het
Scara5 C A 14: 65,759,608 R390S possibly damaging Het
Scin C T 12: 40,079,805 V330I probably benign Het
Sdr42e1 T A 8: 117,663,268 R211S probably benign Het
Slc36a3 C A 11: 55,129,669 A292S probably benign Het
Spata31d1a T C 13: 59,701,110 D1068G probably benign Het
Srd5a1 T A 13: 69,611,219 D10V probably damaging Het
Sspo G T 6: 48,492,889 C4507F probably damaging Het
Tmem94 G A 11: 115,797,971 E1335K probably damaging Het
Tnfrsf13b C T 11: 61,140,916 Q28* probably null Het
Tspan3 A T 9: 56,147,154 F88I probably benign Het
Ttn T C 2: 76,762,175 K20871R probably benign Het
Ube2j2 C A 4: 155,957,338 Y263* probably null Het
Vcan T C 13: 89,691,858 T1856A probably benign Het
Vrk3 T C 7: 44,764,161 L218P probably damaging Het
Zfp236 G T 18: 82,639,336 H761N probably damaging Het
Zfp462 C A 4: 55,011,907 A1291E probably damaging Het
Zfp827 T A 8: 79,118,258 S686T possibly damaging Het
Other mutations in Mlh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Mlh1 APN 9 111252912 missense possibly damaging 0.84
IGL02530:Mlh1 APN 9 111229875 missense probably benign 0.09
IGL02811:Mlh1 APN 9 111271514 missense probably benign 0.04
IGL02892:Mlh1 APN 9 111252969 missense probably benign 0.00
IGL03394:Mlh1 APN 9 111268243 missense probably damaging 1.00
andalusia UTSW 9 111271410 makesense probably null
andalusia2 UTSW 9 111271523 start codon destroyed probably null 0.93
andalusia3 UTSW 9 111229838 critical splice donor site probably null
ANU23:Mlh1 UTSW 9 111252912 missense possibly damaging 0.84
PIT4495001:Mlh1 UTSW 9 111247260 missense probably benign 0.00
R0496:Mlh1 UTSW 9 111241556 missense probably benign
R0723:Mlh1 UTSW 9 111271472 missense probably damaging 1.00
R1395:Mlh1 UTSW 9 111247377 missense probably damaging 1.00
R1694:Mlh1 UTSW 9 111228475 missense probably damaging 1.00
R1762:Mlh1 UTSW 9 111229929 missense probably damaging 1.00
R1865:Mlh1 UTSW 9 111257024 intron probably benign
R1885:Mlh1 UTSW 9 111258556 missense probably benign 0.18
R1992:Mlh1 UTSW 9 111228563 missense probably damaging 0.96
R2186:Mlh1 UTSW 9 111258566 unclassified probably benign
R2680:Mlh1 UTSW 9 111236017 critical splice acceptor site probably null
R4693:Mlh1 UTSW 9 111255658 missense probably damaging 1.00
R4784:Mlh1 UTSW 9 111239798 missense probably benign
R5007:Mlh1 UTSW 9 111271410 makesense probably null
R5130:Mlh1 UTSW 9 111229838 critical splice donor site probably null
R5166:Mlh1 UTSW 9 111241513 missense probably benign 0.04
R5265:Mlh1 UTSW 9 111271523 start codon destroyed probably null 0.93
R5481:Mlh1 UTSW 9 111229837 splice site probably null
R5483:Mlh1 UTSW 9 111231058 missense possibly damaging 0.82
R5602:Mlh1 UTSW 9 111252878 missense probably damaging 0.97
R5658:Mlh1 UTSW 9 111247380 missense probably damaging 0.99
R5890:Mlh1 UTSW 9 111228495 missense possibly damaging 0.88
R6810:Mlh1 UTSW 9 111241558 missense possibly damaging 0.52
R7607:Mlh1 UTSW 9 111229890 missense probably damaging 1.00
R7753:Mlh1 UTSW 9 111252863 critical splice donor site probably null
R7912:Mlh1 UTSW 9 111261513 missense possibly damaging 0.69
R7977:Mlh1 UTSW 9 111230077 intron probably null
R7993:Mlh1 UTSW 9 111261513 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AGCTAAGAGTTGGGCTTCTCAAG -3'
(R):5'- CAACGTTACTTGTGTGGGACTG -3'

Sequencing Primer
(F):5'- CCATCATGTAAATGGGAAACGGTC -3'
(R):5'- ACTGGAGGTATGAAGAGGTCTTTAC -3'
Posted On2020-01-23