Incidental Mutation 'R8033:Olfr1036'
ID618069
Institutional Source Beutler Lab
Gene Symbol Olfr1036
Ensembl Gene ENSMUSG00000099820
Gene Nameolfactory receptor 1036
SynonymsGA_x6K02T2Q125-47549689-47550621, MOR245-25, MOR262-13
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock #R8033 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location86073992-86077194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86074875 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 45 (I45N)
Ref Sequence ENSEMBL: ENSMUSP00000130843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164985]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164985
AA Change: I45N

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130843
Gene: ENSMUSG00000099820
AA Change: I45N

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.2e-51 PFAM
Pfam:7tm_1 39 288 1.1e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,036,522 I1335K probably damaging Het
Adgrb2 A G 4: 130,019,012 E1277G probably benign Het
Agbl3 A G 6: 34,839,494 T785A possibly damaging Het
Ahnak T C 19: 9,003,710 V786A probably benign Het
Armc2 A G 10: 42,008,684 I87T possibly damaging Het
Asap2 T C 12: 21,224,389 S373P probably damaging Het
Casd1 A T 6: 4,619,773 I173F probably benign Het
Chd2 A G 7: 73,435,880 Y1669H probably damaging Het
Clic3 A G 2: 25,458,605 E199G probably benign Het
Cpa4 G A 6: 30,590,800 V366I probably benign Het
Creg2 T C 1: 39,650,627 Y105C probably damaging Het
Cyp20a1 T C 1: 60,372,591 I266T probably benign Het
Dido1 T C 2: 180,674,842 D685G probably damaging Het
Dopey2 C G 16: 93,769,483 R1051G probably benign Het
Fam114a2 A G 11: 57,507,507 S202P probably damaging Het
Fance G T 17: 28,313,685 probably benign Het
Farsa T A 8: 84,867,569 L316Q probably benign Het
Fcrl6 T C 1: 172,599,181 D66G probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gh A T 11: 106,300,555 D154E probably benign Het
Gm11487 T C 4: 73,403,092 N143D probably benign Het
Kmt2a A T 9: 44,845,470 V1160E probably damaging Het
Lct T C 1: 128,285,259 T1886A probably benign Het
Lrwd1 G A 5: 136,123,225 L633F probably damaging Het
Mmp15 A T 8: 95,367,962 N155Y probably benign Het
Mtf2 T G 5: 108,087,085 C125G probably damaging Het
Muc16 A T 9: 18,636,606 D6130E probably benign Het
Orc1 T A 4: 108,605,564 Y613N probably damaging Het
Pak1 A G 7: 97,886,383 N227S probably benign Het
Pex3 G A 10: 13,531,280 Q306* probably null Het
Pld1 A T 3: 28,029,210 M160L probably benign Het
Plekhh1 G A 12: 79,070,936 R902H probably benign Het
Prp2 A G 6: 132,600,428 H226R unknown Het
Rad21 T G 15: 51,964,232 T578P probably damaging Het
Sp140 G A 1: 85,620,094 V181I probably benign Het
Spen A G 4: 141,471,746 V3190A probably benign Het
Spg11 A C 2: 122,086,951 C1011W probably damaging Het
Syngr3 G A 17: 24,686,605 R132* probably null Het
Tbc1d10c A G 19: 4,188,014 F254L possibly damaging Het
Tcea1 T A 1: 4,891,918 I176K probably damaging Het
Timm50 G A 7: 28,306,833 A281V possibly damaging Het
Tmem144 C T 3: 79,825,317 R218K probably benign Het
Upp2 A G 2: 58,780,059 Y259C probably damaging Het
Vcan A G 13: 89,704,360 V827A probably benign Het
Vps41 T A 13: 18,810,465 W161R possibly damaging Het
Zfp994 A T 17: 22,200,684 I428N probably damaging Het
Other mutations in Olfr1036
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Olfr1036 APN 2 86075472 missense possibly damaging 0.90
IGL02370:Olfr1036 APN 2 86074788 missense probably damaging 0.98
R0269:Olfr1036 UTSW 2 86075141 missense probably benign 0.03
R0409:Olfr1036 UTSW 2 86075302 nonsense probably null
R0412:Olfr1036 UTSW 2 86075091 missense probably benign 0.16
R0617:Olfr1036 UTSW 2 86075141 missense probably benign 0.03
R0846:Olfr1036 UTSW 2 86075166 missense possibly damaging 0.66
R1251:Olfr1036 UTSW 2 86074820 missense probably benign 0.20
R1646:Olfr1036 UTSW 2 86075616 missense probably damaging 0.98
R1670:Olfr1036 UTSW 2 86075250 missense probably benign
R1775:Olfr1036 UTSW 2 86074760 missense possibly damaging 0.88
R1968:Olfr1036 UTSW 2 86075205 missense probably damaging 1.00
R2877:Olfr1036 UTSW 2 86075331 missense possibly damaging 0.82
R4639:Olfr1036 UTSW 2 86075579 missense probably benign 0.24
R4957:Olfr1036 UTSW 2 86075510 missense probably damaging 1.00
R5267:Olfr1036 UTSW 2 86075538 missense probably benign 0.28
R5862:Olfr1036 UTSW 2 86075646 missense probably benign 0.00
R6235:Olfr1036 UTSW 2 86075166 missense possibly damaging 0.66
R6355:Olfr1036 UTSW 2 86074872 missense probably benign 0.04
R6943:Olfr1036 UTSW 2 86074920 missense probably damaging 1.00
R8796:Olfr1036 UTSW 2 86075174 missense possibly damaging 0.94
R8861:Olfr1036 UTSW 2 86075616 missense probably damaging 0.98
Z1088:Olfr1036 UTSW 2 86075323 missense possibly damaging 0.66
Z1177:Olfr1036 UTSW 2 86075424 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTACCCTGTAACACATTTGAAC -3'
(R):5'- AAGTAGCACTGTACCAAGCATC -3'

Sequencing Primer
(F):5'- ACCCTGTAACACATTTGAACATTTAG -3'
(R):5'- GCACTGTACCAAGCATCCAACATAAG -3'
Posted On2020-01-23