Incidental Mutation 'R8044:Abcc4'
ID 618683
Institutional Source Beutler Lab
Gene Symbol Abcc4
Ensembl Gene ENSMUSG00000032849
Gene Name ATP-binding cassette, sub-family C (CFTR/MRP), member 4
Synonyms MRP4, D630049P08Rik, MOAT-B
MMRRC Submission
Accession Numbers

Genbank: NM_001033336.3, NM_001163675.1, NM_001163676.1; Ensembl: ENSMUST00000036554

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8044 (G1)
Quality Score 217.468
Status Validated
Chromosome 14
Chromosomal Location 118482692-118706219 bp(-) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) ACCAGCCC to ACC at 118615270 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000042186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036554] [ENSMUST00000166646]
AlphaFold E9Q236
Predicted Effect probably null
Transcript: ENSMUST00000036554
SMART Domains Protein: ENSMUSP00000042186
Gene: ENSMUSG00000032849

DomainStartEndE-ValueType
Pfam:ABC_membrane 92 365 4.5e-37 PFAM
AAA 437 610 5.71e-12 SMART
Pfam:ABC_membrane 714 993 4.2e-47 PFAM
AAA 1067 1251 2.02e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166646
SMART Domains Protein: ENSMUSP00000129677
Gene: ENSMUSG00000032849

DomainStartEndE-ValueType
Pfam:ABC_membrane 98 290 4.1e-22 PFAM
AAA 362 535 5.71e-12 SMART
Pfam:ABC_membrane 638 922 4.6e-39 PFAM
AAA 992 1176 2.02e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This family member plays a role in cellular detoxification as a pump for its substrate, organic anions. It may also function in prostaglandin-mediated cAMP signaling in ciliogenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice are viable and fertile. Homozygotes for one null allele display impaired organic anion transport in the blood-brain and blood-cerebrospinal fluid barriers and kidney. Homozygotes for a second null allele display hypoalgesia and abnormal PGE2 physiology. [provided by MGI curators]
Allele List at MGI

All alleles(143) : Targeted, knock-out(2) Gene trapped(141)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524J17Rik T C 8: 85,412,118 E114G possibly damaging Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Asb7 T C 7: 66,659,763 N235S probably benign Het
Atrn A T 2: 130,935,529 N166I probably damaging Het
C87499 T G 4: 88,629,975 E64D possibly damaging Het
Cd300ld2 C T 11: 115,013,719 W107* probably null Het
Chl1 A T 6: 103,706,632 E806D probably damaging Het
Dnajb12 A G 10: 59,896,350 K337R possibly damaging Het
Dock5 T C 14: 67,824,692 D409G probably damaging Het
Efhb G A 17: 53,399,115 S798L probably benign Het
Gpd1 T C 15: 99,723,202 F322S probably damaging Het
Gria4 A G 9: 4,456,216 Y695H probably damaging Het
Ipo8 A G 6: 148,809,923 F289S probably damaging Het
Jakmip1 A G 5: 37,154,644 E72G unknown Het
Mettl14 T C 3: 123,369,660 N366S probably benign Het
Ntrk2 A G 13: 59,126,499 T730A probably damaging Het
Olfr1453 T C 19: 13,027,465 Y288C probably damaging Het
Otop3 T C 11: 115,346,435 L575P probably damaging Het
Piwil2 T C 14: 70,391,438 S710G possibly damaging Het
Ptpra A G 2: 130,544,961 K627E possibly damaging Het
Rab24 A G 13: 55,321,532 probably benign Het
Rbm20 C A 19: 53,817,971 A494D probably benign Het
Rpe65 T C 3: 159,614,705 F300L probably benign Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tert A G 13: 73,635,449 E590G probably damaging Het
Tlr4 C A 4: 66,827,847 L6I probably benign Het
Trim3 G A 7: 105,613,258 silent Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Ube3a A T 7: 59,276,572 H387L possibly damaging Het
Ugt1a7c G A 1: 88,095,556 V146M probably damaging Het
Upf2 T C 2: 6,029,438 I974T unknown Het
Vmn1r38 A T 6: 66,776,532 I200N probably benign Het
Wnt5b A G 6: 119,446,358 V115A probably damaging Het
Xpo7 C A 14: 70,684,926 R574L probably benign Het
Other mutations in Abcc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Abcc4 APN 14 118528997 missense probably benign 0.03
IGL01152:Abcc4 APN 14 118599385 missense probably damaging 1.00
IGL01511:Abcc4 APN 14 118599341 missense probably benign 0.03
IGL01604:Abcc4 APN 14 118527994 missense possibly damaging 0.94
IGL01725:Abcc4 APN 14 118500829 missense probably damaging 1.00
IGL01828:Abcc4 APN 14 118553279 splice site probably benign
IGL02174:Abcc4 APN 14 118500742 missense probably damaging 0.98
IGL02391:Abcc4 APN 14 118553352 missense probably damaging 1.00
IGL02500:Abcc4 APN 14 118618926 missense possibly damaging 0.47
IGL02598:Abcc4 APN 14 118668369 nonsense probably null
IGL02668:Abcc4 APN 14 118611475 missense probably damaging 1.00
IGL02708:Abcc4 APN 14 118500801 missense probably damaging 1.00
IGL02859:Abcc4 APN 14 118516500 missense probably damaging 1.00
IGL03249:Abcc4 APN 14 118627706 splice site probably benign
IGL03257:Abcc4 APN 14 118615211 missense probably benign 0.01
IGL03298:Abcc4 APN 14 118611468 missense probably damaging 1.00
1mM(1):Abcc4 UTSW 14 118629656 nonsense probably null
R0743:Abcc4 UTSW 14 118553288 missense possibly damaging 0.90
R0884:Abcc4 UTSW 14 118553288 missense possibly damaging 0.90
R1139:Abcc4 UTSW 14 118500840 missense possibly damaging 0.56
R1238:Abcc4 UTSW 14 118597639 splice site probably benign
R1588:Abcc4 UTSW 14 118534072 missense probably benign 0.01
R1678:Abcc4 UTSW 14 118594894 missense probably benign 0.08
R1785:Abcc4 UTSW 14 118553349 missense probably damaging 0.99
R1786:Abcc4 UTSW 14 118553349 missense probably damaging 0.99
R1961:Abcc4 UTSW 14 118611456 missense probably damaging 0.98
R1961:Abcc4 UTSW 14 118611459 missense possibly damaging 0.92
R1993:Abcc4 UTSW 14 118526282 missense probably benign 0.02
R2025:Abcc4 UTSW 14 118553325 missense probably benign 0.13
R3613:Abcc4 UTSW 14 118627451 critical splice donor site probably null
R3864:Abcc4 UTSW 14 118616415 missense probably benign
R4274:Abcc4 UTSW 14 118629622 missense probably damaging 1.00
R4459:Abcc4 UTSW 14 118599393 missense probably benign 0.11
R4601:Abcc4 UTSW 14 118632163 missense probably benign 0.00
R4665:Abcc4 UTSW 14 118529002 missense probably benign
R4678:Abcc4 UTSW 14 118627691 missense probably damaging 0.97
R4771:Abcc4 UTSW 14 118484384 missense probably benign 0.00
R4962:Abcc4 UTSW 14 118668399 missense probably benign 0.33
R4997:Abcc4 UTSW 14 118516503 nonsense probably null
R5273:Abcc4 UTSW 14 118594821 missense possibly damaging 0.76
R5526:Abcc4 UTSW 14 118631037 missense probably benign 0.10
R5652:Abcc4 UTSW 14 118618927 missense probably benign 0.00
R5820:Abcc4 UTSW 14 118604195 missense probably benign 0.14
R5873:Abcc4 UTSW 14 118526290 missense probably benign 0.00
R6008:Abcc4 UTSW 14 118490566 missense possibly damaging 0.63
R6080:Abcc4 UTSW 14 118669050 missense possibly damaging 0.75
R6222:Abcc4 UTSW 14 118529956 missense probably damaging 1.00
R6919:Abcc4 UTSW 14 118594894 missense probably benign 0.08
R6931:Abcc4 UTSW 14 118527988 missense probably damaging 0.99
R7013:Abcc4 UTSW 14 118526343 missense probably benign
R7055:Abcc4 UTSW 14 118594785 nonsense probably null
R7146:Abcc4 UTSW 14 118615181 missense probably damaging 1.00
R7365:Abcc4 UTSW 14 118627654 missense probably damaging 1.00
R7402:Abcc4 UTSW 14 118706075 missense probably damaging 1.00
R7438:Abcc4 UTSW 14 118616446 missense probably benign 0.01
R7528:Abcc4 UTSW 14 118529905 missense probably damaging 0.99
R7674:Abcc4 UTSW 14 118611487 missense probably damaging 1.00
R7769:Abcc4 UTSW 14 118615270 frame shift probably null
R7823:Abcc4 UTSW 14 118534072 missense probably benign 0.01
R7847:Abcc4 UTSW 14 118627480 missense probably damaging 1.00
R7989:Abcc4 UTSW 14 118599360 missense probably benign 0.05
R8214:Abcc4 UTSW 14 118500841 missense probably benign 0.35
R8264:Abcc4 UTSW 14 118594842 missense possibly damaging 0.81
R8309:Abcc4 UTSW 14 118616392 missense probably damaging 1.00
R8369:Abcc4 UTSW 14 118627457 missense probably benign 0.02
R8701:Abcc4 UTSW 14 118599373 missense probably benign
R8942:Abcc4 UTSW 14 118553320 missense probably damaging 1.00
R8994:Abcc4 UTSW 14 118534144 critical splice acceptor site probably null
R9008:Abcc4 UTSW 14 118611750 missense probably damaging 0.98
R9100:Abcc4 UTSW 14 118616388 missense possibly damaging 0.65
R9119:Abcc4 UTSW 14 118631030 missense probably benign 0.16
R9267:Abcc4 UTSW 14 118632245 intron probably benign
Predicted Primers PCR Primer
(F):5'- GAGTATCATGACTTAGAGAACGCC -3'
(R):5'- AGCTGCAGCATCTAGTGACC -3'

Sequencing Primer
(F):5'- AAGGCGGGCGTTTACAC -3'
(R):5'- GCAGCATCTAGTGACCTTTTATATG -3'
Posted On 2020-01-23