Incidental Mutation 'R0655:Esf1'
ID 62460
Institutional Source Beutler Lab
Gene Symbol Esf1
Ensembl Gene ENSMUSG00000045624
Gene Name ESF1 nucleolar pre-rRNA processing protein homolog
MMRRC Submission 038840-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock # R0655 (G1)
Quality Score 94
Status Not validated
Chromosome 2
Chromosomal Location 140119883-140170564 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 140148879 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 562 (T562S)
Ref Sequence ENSEMBL: ENSMUSP00000036523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046030] [ENSMUST00000104994]
AlphaFold Q3V1V3
Predicted Effect probably benign
Transcript: ENSMUST00000046030
AA Change: T562S

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000036523
Gene: ENSMUSG00000045624
AA Change: T562S

coiled coil region 91 114 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 230 258 N/A INTRINSIC
coiled coil region 261 293 N/A INTRINSIC
low complexity region 539 552 N/A INTRINSIC
coiled coil region 628 652 N/A INTRINSIC
low complexity region 667 692 N/A INTRINSIC
low complexity region 730 740 N/A INTRINSIC
Pfam:NUC153 753 781 4.1e-15 PFAM
low complexity region 784 798 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000104994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153769
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 G C 17: 35,957,845 I757M probably benign Het
Atg16l1 T A 1: 87,766,829 I76N probably damaging Het
Baz1b T A 5: 135,242,430 I1289N probably benign Het
Bcl2l15 T A 3: 103,832,969 probably null Het
Btbd11 A G 10: 85,645,526 T931A probably damaging Het
Cbl G T 9: 44,158,752 T566K probably damaging Het
Cbwd1 T C 19: 24,953,320 M122V possibly damaging Het
Cd96 T C 16: 46,099,119 K180E probably benign Het
Cpxm2 G A 7: 132,054,820 T571I possibly damaging Het
Cyp2a12 A T 7: 27,036,621 Y485F probably benign Het
Cyp4f17 T A 17: 32,524,897 Y350N possibly damaging Het
Dstn T A 2: 143,938,422 I14N probably damaging Het
Eea1 A G 10: 95,995,598 S184G probably benign Het
Eif1a G T 18: 46,608,063 G122C probably damaging Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Fig4 T C 10: 41,285,677 N30S probably damaging Het
Gria2 C A 3: 80,732,070 E212* probably null Het
Gsdmc2 C T 15: 63,827,773 A269T probably benign Het
Herc4 T C 10: 63,273,571 V195A probably benign Het
Hivep1 T C 13: 42,167,585 S2123P probably damaging Het
Hspa4 T C 11: 53,269,692 E519G probably benign Het
Htr2b A G 1: 86,110,843 S14P probably benign Het
Ifit1 T C 19: 34,647,647 V61A probably damaging Het
Ifitm1 C A 7: 140,969,536 F77L probably benign Het
Matn2 T C 15: 34,345,200 S118P probably benign Het
Mtmr3 C A 11: 4,488,610 D615Y probably damaging Het
Mtss1 C A 15: 59,081,502 C9F probably damaging Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Nwd2 T C 5: 63,791,585 S167P possibly damaging Het
Olfr394 T C 11: 73,887,805 D189G possibly damaging Het
Olfr694 A T 7: 106,689,425 F102Y probably damaging Het
Olfr921 C T 9: 38,775,554 Q100* probably null Het
Oscp1 T C 4: 126,058,733 L18P probably damaging Het
Pax5 A G 4: 44,537,462 S297P probably damaging Het
Phldb3 A T 7: 24,624,372 D476V probably benign Het
Phlpp2 A T 8: 109,895,587 I154L probably benign Het
Prx T A 7: 27,517,421 V449E probably damaging Het
Psd3 A G 8: 67,963,689 S519P probably benign Het
Rnf138 T G 18: 21,010,783 V128G probably benign Het
Safb T A 17: 56,597,803 S209T probably benign Het
Sbno1 C A 5: 124,376,149 V1327L possibly damaging Het
Scarb1 A G 5: 125,300,440 V176A probably damaging Het
Scd4 A G 19: 44,338,968 H161R possibly damaging Het
Selenoo T A 15: 89,095,655 H335Q probably damaging Het
Slfn8 A G 11: 83,003,821 F664S probably benign Het
Spef2 T C 15: 9,626,131 I1116M possibly damaging Het
Taf2 G A 15: 55,038,294 R835W probably damaging Het
Tdrd9 A G 12: 112,040,465 E921G probably damaging Het
Tectb G A 19: 55,189,870 G234S possibly damaging Het
Tmc1 C T 19: 20,799,176 M606I probably damaging Het
Tmed10 T A 12: 85,343,517 I88F probably damaging Het
Tnfrsf11a G A 1: 105,808,155 V31I unknown Het
Trp53inp2 G T 2: 155,386,168 G98* probably null Het
Tssc4 A G 7: 143,070,045 D30G probably damaging Het
Uaca T C 9: 60,872,029 Y1233H probably benign Het
Unc13c G A 9: 73,930,953 T872I probably damaging Het
Unc80 A G 1: 66,503,781 H398R probably damaging Het
Vmn1r64 G A 7: 5,884,208 T112I probably benign Het
Vmn1r85 A G 7: 13,084,723 Y165H probably damaging Het
Vmn2r72 A T 7: 85,738,111 C748* probably null Het
Wdr17 A G 8: 54,649,198 W929R probably damaging Het
Yeats2 A T 16: 20,193,824 K591* probably null Het
Zbtb9 T A 17: 26,974,100 S160T probably damaging Het
Znfx1 T A 2: 167,056,907 R32S probably damaging Het
Other mutations in Esf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Esf1 APN 2 140167817 missense probably benign 0.09
IGL01075:Esf1 APN 2 140120745 missense probably benign 0.01
IGL01777:Esf1 APN 2 140157172 splice site probably null
IGL01863:Esf1 APN 2 140120679 missense probably benign 0.00
IGL01982:Esf1 APN 2 140164528 missense probably benign 0.00
IGL02040:Esf1 APN 2 140129261 missense possibly damaging 0.70
IGL02063:Esf1 APN 2 140164457 missense possibly damaging 0.88
IGL03063:Esf1 APN 2 140154786 unclassified probably benign
PIT4418001:Esf1 UTSW 2 140159777 missense probably benign 0.18
R0255:Esf1 UTSW 2 140148923 unclassified probably benign
R0388:Esf1 UTSW 2 140120871 missense possibly damaging 0.71
R0564:Esf1 UTSW 2 140158586 missense possibly damaging 0.86
R0831:Esf1 UTSW 2 140168359 missense probably damaging 1.00
R1642:Esf1 UTSW 2 140158486 missense possibly damaging 0.85
R1984:Esf1 UTSW 2 140148886 missense possibly damaging 0.83
R3981:Esf1 UTSW 2 140158556 missense probably benign 0.40
R4736:Esf1 UTSW 2 140124971 missense probably damaging 0.98
R5083:Esf1 UTSW 2 140157071 missense possibly damaging 0.93
R5083:Esf1 UTSW 2 140158579 missense possibly damaging 0.96
R5222:Esf1 UTSW 2 140158583 missense possibly damaging 0.86
R5347:Esf1 UTSW 2 140154881 nonsense probably null
R5654:Esf1 UTSW 2 140164228 missense possibly damaging 0.85
R6123:Esf1 UTSW 2 140168389 missense probably benign 0.01
R6132:Esf1 UTSW 2 140159779 missense probably benign 0.18
R6299:Esf1 UTSW 2 140123634 missense possibly damaging 0.53
R6484:Esf1 UTSW 2 140158538 missense probably benign 0.03
R6541:Esf1 UTSW 2 140167879 missense probably benign 0.00
R6674:Esf1 UTSW 2 140120806 nonsense probably null
R7203:Esf1 UTSW 2 140164219 missense possibly damaging 0.53
R7309:Esf1 UTSW 2 140125091 splice site probably null
R7379:Esf1 UTSW 2 140154934 missense probably benign 0.33
R8131:Esf1 UTSW 2 140148831 nonsense probably null
R8270:Esf1 UTSW 2 140155113 unclassified probably benign
R9066:Esf1 UTSW 2 140148773 missense probably benign 0.02
R9186:Esf1 UTSW 2 140148872 missense possibly damaging 0.96
R9618:Esf1 UTSW 2 140159794 missense probably benign 0.03
RF006:Esf1 UTSW 2 140164374 small deletion probably benign
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tgggaggagtagggaaaagg -3'
Posted On 2013-07-30