Incidental Mutation 'R8092:Zbtb42'
ID629951
Institutional Source Beutler Lab
Gene Symbol Zbtb42
Ensembl Gene ENSMUSG00000037638
Gene Namezinc finger and BTB domain containing 42
SynonymsGm5188, simiRP58
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8092 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location112678828-112682747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 112679841 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 150 (C150F)
Ref Sequence ENSEMBL: ENSMUSP00000133152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000144550] [ENSMUST00000169593] [ENSMUST00000173942] [ENSMUST00000174780]
Predicted Effect probably benign
Transcript: ENSMUST00000144550
SMART Domains Protein: ENSMUSP00000123689
Gene: ENSMUSG00000001729

DomainStartEndE-ValueType
PH 6 110 2.41e-16 SMART
Pfam:Pkinase 150 202 2.6e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169593
AA Change: C150F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133152
Gene: ENSMUSG00000037638
AA Change: C150F

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
BTB 24 122 8.88e-22 SMART
low complexity region 226 241 N/A INTRINSIC
ZnF_C2H2 292 314 3.02e0 SMART
ZnF_C2H2 332 354 2.02e-1 SMART
ZnF_C2H2 360 382 5.06e-2 SMART
ZnF_C2H2 388 411 2.71e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173942
AA Change: C68F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133987
Gene: ENSMUSG00000037638
AA Change: C68F

DomainStartEndE-ValueType
Blast:BTB 1 40 8e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174780
SMART Domains Protein: ENSMUSP00000134028
Gene: ENSMUSG00000037638

DomainStartEndE-ValueType
Pfam:BTB 1 40 1.3e-5 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the C2H2 zinc finger protein family. This protein is predicted to have a pox virus and zinc finger (POZ) domain at the N-terminus and four zinc finger domains at the C-terminus. In human and mouse, the protein localizes to the nuclei of skeletal muscle cells. Knockdown of this gene in zebrafish results in abnormal skeletal muscle development and myofibrillar disorganization. A novel homozygous variant of the human gene has been associated with lethal congenital contracture syndrome, an autosomal recessive disorder that results in muscle wasting. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 T C 12: 88,461,061 S483P possibly damaging Het
Agr3 T A 12: 35,947,594 probably null Het
Anxa4 T C 6: 86,741,891 D282G probably damaging Het
Aplp2 A C 9: 31,163,344 probably null Het
Arfgef2 G A 2: 166,859,834 V714M probably damaging Het
Cep295 A T 9: 15,332,982 F1393I probably benign Het
Cfap206 G A 4: 34,728,897 P3S possibly damaging Het
Chd5 T A 4: 152,378,804 D1410E probably damaging Het
Chd8 T C 14: 52,217,727 Y1101C probably damaging Het
Chtf8 A G 8: 106,886,306 V121A possibly damaging Het
Diexf G A 1: 193,120,363 L349F probably benign Het
Dpys C T 15: 39,846,614 D140N probably benign Het
Dsg1c A G 18: 20,281,972 Y642C probably damaging Het
Eif2ak4 G A 2: 118,442,032 V901I probably damaging Het
Gm45861 T C 8: 27,567,795 M1127T unknown Het
Gnpnat1 A G 14: 45,380,931 probably null Het
Hsd3b6 T A 3: 98,806,140 D281V possibly damaging Het
Kng2 T A 16: 22,987,922 Q509L probably benign Het
Lipo2 A T 19: 33,749,480 D52E probably benign Het
Ly6g6c A G 17: 35,068,891 Y27C probably damaging Het
Mcc G A 18: 44,759,232 T105I probably benign Het
Mettl11b A G 1: 163,717,250 Y55H probably damaging Het
Neurl4 A G 11: 69,911,065 K1279E probably benign Het
Ntn4 A C 10: 93,741,056 K529Q probably damaging Het
Olfr1308 C A 2: 111,960,307 M255I probably benign Het
P2ry14 C T 3: 59,115,446 V198M probably damaging Het
Pclo T A 5: 14,677,546 D2139E unknown Het
Plxnb1 T A 9: 109,100,505 V143E probably damaging Het
Prune2 G T 19: 17,119,993 D954Y probably damaging Het
Qrsl1 G A 10: 43,884,753 P278L probably damaging Het
Rnf17 C T 14: 56,487,022 R1108C probably benign Het
Sipa1l2 T C 8: 125,419,168 S1716G probably benign Het
Slfn4 A T 11: 83,189,005 H507L probably benign Het
Snx18 T C 13: 113,617,149 E416G probably damaging Het
Srp9 T C 1: 182,131,436 V81A probably benign Het
Tex101 G A 7: 24,670,353 T62M probably damaging Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Other mutations in Zbtb42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Zbtb42 APN 12 112680284 missense probably benign 0.35
R0607:Zbtb42 UTSW 12 112680627 missense probably benign 0.32
R4586:Zbtb42 UTSW 12 112680542 missense probably damaging 1.00
R4607:Zbtb42 UTSW 12 112680542 missense probably damaging 1.00
R4609:Zbtb42 UTSW 12 112680542 missense probably damaging 1.00
R4890:Zbtb42 UTSW 12 112680427 nonsense probably null
R5143:Zbtb42 UTSW 12 112679514 missense probably damaging 1.00
R5933:Zbtb42 UTSW 12 112680621 missense probably damaging 1.00
R6066:Zbtb42 UTSW 12 112679607 missense probably damaging 1.00
R6245:Zbtb42 UTSW 12 112679535 missense probably damaging 1.00
R6974:Zbtb42 UTSW 12 112680390 missense probably damaging 0.97
R8253:Zbtb42 UTSW 12 112680312 missense probably damaging 1.00
Z1176:Zbtb42 UTSW 12 112680199 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCACAACCTACCTGTCGAG -3'
(R):5'- ACGAATCTTGCTCAGCCTTC -3'

Sequencing Primer
(F):5'- AACCTACCTGTCGAGGACGTC -3'
(R):5'- TTGCTCAGCCTTCACCAGAGG -3'
Posted On2020-06-30