Incidental Mutation 'R4609:Zbtb42'
ID344539
Institutional Source Beutler Lab
Gene Symbol Zbtb42
Ensembl Gene ENSMUSG00000037638
Gene Namezinc finger and BTB domain containing 42
SynonymsGm5188, simiRP58
MMRRC Submission 041820-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4609 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location112678828-112682747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 112680542 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 384 (R384W)
Ref Sequence ENSEMBL: ENSMUSP00000133152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169593] [ENSMUST00000173942] [ENSMUST00000174780]
Predicted Effect probably damaging
Transcript: ENSMUST00000169593
AA Change: R384W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133152
Gene: ENSMUSG00000037638
AA Change: R384W

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
BTB 24 122 8.88e-22 SMART
low complexity region 226 241 N/A INTRINSIC
ZnF_C2H2 292 314 3.02e0 SMART
ZnF_C2H2 332 354 2.02e-1 SMART
ZnF_C2H2 360 382 5.06e-2 SMART
ZnF_C2H2 388 411 2.71e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173942
SMART Domains Protein: ENSMUSP00000133987
Gene: ENSMUSG00000037638

DomainStartEndE-ValueType
Blast:BTB 1 40 8e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174780
SMART Domains Protein: ENSMUSP00000134028
Gene: ENSMUSG00000037638

DomainStartEndE-ValueType
Pfam:BTB 1 40 1.3e-5 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the C2H2 zinc finger protein family. This protein is predicted to have a pox virus and zinc finger (POZ) domain at the N-terminus and four zinc finger domains at the C-terminus. In human and mouse, the protein localizes to the nuclei of skeletal muscle cells. Knockdown of this gene in zebrafish results in abnormal skeletal muscle development and myofibrillar disorganization. A novel homozygous variant of the human gene has been associated with lethal congenital contracture syndrome, an autosomal recessive disorder that results in muscle wasting. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7530416G11Rik T C 15: 85,494,169 D91G unknown Het
Adam10 T C 9: 70,740,143 Y42H probably damaging Het
Baiap3 A T 17: 25,250,261 C183S probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bmp1 C T 14: 70,477,966 V910M probably benign Het
Brdt G A 5: 107,359,936 A677T probably benign Het
Cadps2 A T 6: 23,587,579 M304K probably damaging Het
Car9 A T 4: 43,507,267 D71V possibly damaging Het
Chml A T 1: 175,687,157 Y399* probably null Het
Clasp1 A G 1: 118,503,035 probably benign Het
Cntnap5b G A 1: 99,772,847 probably null Het
Cpvl A T 6: 53,974,620 probably null Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Cxcl16 T C 11: 70,455,429 Y226C probably damaging Het
Dio3 G T 12: 110,280,010 R260L probably damaging Het
Dmxl2 A G 9: 54,446,512 L724P probably damaging Het
Dnah7a A C 1: 53,456,657 F3214V possibly damaging Het
Dpy19l4 A T 4: 11,295,999 Y223* probably null Het
Dpysl4 T C 7: 139,098,621 V499A probably damaging Het
Ets2 A T 16: 95,711,774 K101N probably benign Het
Fam160a2 A G 7: 105,388,224 I384T probably damaging Het
Fbn2 A T 18: 58,190,269 Y200* probably null Het
Fem1c A T 18: 46,505,948 I329N probably damaging Het
Gm8919 T C 3: 11,659,470 noncoding transcript Het
H2-Q5 A T 17: 35,397,080 H206L probably benign Het
Hexa T C 9: 59,557,319 F164S probably benign Het
Hk1 G T 10: 62,358,415 probably benign Het
Ick T A 9: 78,167,789 probably benign Het
Itih4 G A 14: 30,901,669 G915R probably damaging Het
Kcnq5 A T 1: 21,405,068 probably null Het
Krtap10-4 A T 10: 77,826,796 probably benign Het
Maml3 G T 3: 51,855,592 H650Q probably damaging Het
Mief1 C A 15: 80,248,253 P112Q probably benign Het
Morc3 A G 16: 93,864,968 E472G probably benign Het
Nap1l1 T A 10: 111,492,880 Y223* probably null Het
Nfix A T 8: 84,726,490 W312R probably damaging Het
Nfkbie A T 17: 45,558,584 N155I probably damaging Het
Nlgn2 A T 11: 69,834,086 M118K probably damaging Het
Nlrp5 A T 7: 23,417,748 Y299F probably benign Het
Nnt T C 13: 119,357,536 I556V possibly damaging Het
Oasl2 A T 5: 114,899,796 I85F possibly damaging Het
Ogg1 A C 6: 113,328,432 T69P probably damaging Het
Olfml2a G T 2: 38,957,721 V431L probably damaging Het
Olfr507 A T 7: 108,622,504 M231L probably benign Het
Olfr984 T C 9: 40,100,806 H228R possibly damaging Het
Palb2 G T 7: 122,124,723 A601E probably benign Het
Pcdhb20 G A 18: 37,505,796 M458I probably benign Het
Pde11a T C 2: 76,291,241 D332G possibly damaging Het
Pkd1l1 C T 11: 8,958,964 E347K unknown Het
Pou2af1 G A 9: 51,238,225 V206I possibly damaging Het
Prr16 A G 18: 51,118,067 D46G possibly damaging Het
Pus1 A G 5: 110,780,318 M1T probably null Het
Pygm T A 19: 6,391,409 V566D possibly damaging Het
Rb1 T A 14: 73,262,514 probably benign Het
Rhoj A T 12: 75,400,206 K200* probably null Het
Rnf213 A G 11: 119,437,695 I1985V possibly damaging Het
Sept11 G T 5: 93,162,254 M305I possibly damaging Het
Setdb2 T C 14: 59,415,704 Y383C probably damaging Het
Sfpq G C 4: 127,021,611 Q65H unknown Het
Stard3nl G T 13: 19,370,264 A180E probably damaging Het
Tanc2 A G 11: 105,910,240 N1094S probably benign Het
Trf C T 9: 103,211,985 A554T possibly damaging Het
Trmt13 T C 3: 116,594,827 probably benign Het
Tubb3 A G 8: 123,420,919 D197G probably damaging Het
Ube2e3 A G 2: 78,918,712 H135R probably damaging Het
Ugt1a10 A T 1: 88,055,482 M1L possibly damaging Het
Vmn1r233 A T 17: 20,994,415 I91N possibly damaging Het
Vmn2r88 A T 14: 51,418,074 D580V probably damaging Het
Vps33b A G 7: 80,291,118 Y593C probably benign Het
Wdr19 A G 5: 65,228,542 T622A possibly damaging Het
Wdr3 C T 3: 100,140,200 R853Q probably damaging Het
Wdr61 A G 9: 54,728,179 V46A probably benign Het
Xirp1 T C 9: 120,016,506 T1104A probably benign Het
Yipf1 G A 4: 107,344,683 probably null Het
Zbtb17 A G 4: 141,466,498 D651G probably damaging Het
Zbtb43 A T 2: 33,454,043 M390K probably benign Het
Zfp462 C T 4: 55,011,889 T1285M probably damaging Het
Other mutations in Zbtb42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Zbtb42 APN 12 112680284 missense probably benign 0.35
R0607:Zbtb42 UTSW 12 112680627 missense probably benign 0.32
R4586:Zbtb42 UTSW 12 112680542 missense probably damaging 1.00
R4607:Zbtb42 UTSW 12 112680542 missense probably damaging 1.00
R4890:Zbtb42 UTSW 12 112680427 nonsense probably null
R5143:Zbtb42 UTSW 12 112679514 missense probably damaging 1.00
R5933:Zbtb42 UTSW 12 112680621 missense probably damaging 1.00
R6066:Zbtb42 UTSW 12 112679607 missense probably damaging 1.00
R6245:Zbtb42 UTSW 12 112679535 missense probably damaging 1.00
R6974:Zbtb42 UTSW 12 112680390 missense probably damaging 0.97
R8092:Zbtb42 UTSW 12 112679841 missense probably damaging 1.00
R8253:Zbtb42 UTSW 12 112680312 missense probably damaging 1.00
Z1176:Zbtb42 UTSW 12 112680199 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTATGCTGCAAGCTGTTCC -3'
(R):5'- TAGCCTTGGGGTAGTGCTAC -3'

Sequencing Primer
(F):5'- GCAAGCTGTTCCCTAGCAC -3'
(R):5'- TAGTGCTACCACCGGCCTG -3'
Posted On2015-09-25