Incidental Mutation 'R8092:Chd5'
ID 629935
Institutional Source Beutler Lab
Gene Symbol Chd5
Ensembl Gene ENSMUSG00000005045
Gene Name chromodomain helicase DNA binding protein 5
Synonyms B230399N07Rik, 4930532L22Rik
MMRRC Submission 067524-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8092 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 152423108-152474651 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 152463261 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1410 (D1410E)
Ref Sequence ENSEMBL: ENSMUSP00000132600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005175] [ENSMUST00000030775] [ENSMUST00000164662]
AlphaFold A2A8L1
Predicted Effect possibly damaging
Transcript: ENSMUST00000005175
AA Change: D1447E

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000005175
Gene: ENSMUSG00000005045
AA Change: D1447E

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
Pfam:CHDNT 149 203 2e-32 PFAM
low complexity region 209 220 N/A INTRINSIC
low complexity region 256 273 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
PHD 347 390 1.09e-14 SMART
RING 348 389 4.48e-1 SMART
low complexity region 400 416 N/A INTRINSIC
PHD 420 463 3.29e-14 SMART
RING 421 462 4.15e0 SMART
CHROMO 468 548 2.52e-13 SMART
CHROMO 592 649 1.34e-8 SMART
low complexity region 657 678 N/A INTRINSIC
DEXDc 698 910 8.34e-33 SMART
low complexity region 1023 1038 N/A INTRINSIC
HELICc 1056 1140 4.02e-26 SMART
DUF1087 1297 1361 2.78e-33 SMART
DUF1086 1374 1533 5.11e-105 SMART
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1685 1701 N/A INTRINSIC
Pfam:CHDCT2 1729 1901 1.7e-99 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000030775
AA Change: D1447E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030775
Gene: ENSMUSG00000005045
AA Change: D1447E

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
Pfam:CHDNT 150 203 9e-28 PFAM
low complexity region 209 220 N/A INTRINSIC
low complexity region 256 273 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
PHD 347 390 1.09e-14 SMART
RING 348 389 4.48e-1 SMART
low complexity region 400 416 N/A INTRINSIC
PHD 420 463 3.29e-14 SMART
RING 421 462 4.15e0 SMART
CHROMO 468 548 2.52e-13 SMART
CHROMO 592 649 1.34e-8 SMART
low complexity region 657 678 N/A INTRINSIC
DEXDc 698 910 8.34e-33 SMART
low complexity region 1023 1038 N/A INTRINSIC
HELICc 1056 1140 4.02e-26 SMART
DUF1087 1297 1361 2.78e-33 SMART
DUF1086 1374 1533 5.11e-105 SMART
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1685 1701 N/A INTRINSIC
Pfam:CHDCT2 1730 1901 2.8e-93 PFAM
low complexity region 1922 1936 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164662
AA Change: D1410E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132600
Gene: ENSMUSG00000005045
AA Change: D1410E

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
Pfam:CHDNT 149 203 1.9e-32 PFAM
low complexity region 209 220 N/A INTRINSIC
low complexity region 256 273 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
PHD 347 390 1.09e-14 SMART
RING 348 389 4.48e-1 SMART
low complexity region 400 416 N/A INTRINSIC
PHD 420 463 3.29e-14 SMART
RING 421 462 4.15e0 SMART
CHROMO 468 548 2.52e-13 SMART
CHROMO 592 649 1.34e-8 SMART
low complexity region 657 678 N/A INTRINSIC
DEXDc 698 910 8.34e-33 SMART
low complexity region 1023 1038 N/A INTRINSIC
HELICc 1056 1140 4.02e-26 SMART
DUF1087 1260 1324 2.78e-33 SMART
DUF1086 1337 1496 5.11e-105 SMART
low complexity region 1515 1530 N/A INTRINSIC
low complexity region 1648 1664 N/A INTRINSIC
Pfam:CHDCT2 1692 1864 1.7e-99 PFAM
low complexity region 1885 1899 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chromodomain helicase DNA-binding protein family. Members of this family are characterized by a chromodomain, a helicase ATP-binding domain and an additional functional domain. This gene encodes a neuron-specific protein that may function in chromatin remodeling and gene transcription. This gene is a potential tumor suppressor gene that may play a role in the development of neuroblastoma. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility with abnormal spermiogenesis and chromatin condensation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 T C 12: 88,427,831 (GRCm39) S483P possibly damaging Het
Agr3 T A 12: 35,997,593 (GRCm39) probably null Het
Anxa4 T C 6: 86,718,873 (GRCm39) D282G probably damaging Het
Aplp2 A C 9: 31,074,640 (GRCm39) probably null Het
Arfgef2 G A 2: 166,701,754 (GRCm39) V714M probably damaging Het
Cep295 A T 9: 15,244,278 (GRCm39) F1393I probably benign Het
Cfap206 G A 4: 34,728,897 (GRCm39) P3S possibly damaging Het
Chd8 T C 14: 52,455,184 (GRCm39) Y1101C probably damaging Het
Chtf8 A G 8: 107,612,938 (GRCm39) V121A possibly damaging Het
Dnajc3 A T 14: 119,207,994 (GRCm39) probably null Het
Dpys C T 15: 39,710,010 (GRCm39) D140N probably benign Het
Dsg1c A G 18: 20,415,029 (GRCm39) Y642C probably damaging Het
Eif2ak4 G A 2: 118,272,513 (GRCm39) V901I probably damaging Het
Gm45861 T C 8: 28,057,823 (GRCm39) M1127T unknown Het
Gnpnat1 A G 14: 45,618,388 (GRCm39) probably null Het
Hsd3b6 T A 3: 98,713,456 (GRCm39) D281V possibly damaging Het
Kng2 T A 16: 22,806,672 (GRCm39) Q509L probably benign Het
Lipo2 A T 19: 33,726,880 (GRCm39) D52E probably benign Het
Ly6g6c A G 17: 35,287,867 (GRCm39) Y27C probably damaging Het
Mcc G A 18: 44,892,299 (GRCm39) T105I probably benign Het
Neurl4 A G 11: 69,801,891 (GRCm39) K1279E probably benign Het
Ntmt2 A G 1: 163,544,819 (GRCm39) Y55H probably damaging Het
Ntn4 A C 10: 93,576,918 (GRCm39) K529Q probably damaging Het
Or4f57 C A 2: 111,790,652 (GRCm39) M255I probably benign Het
P2ry14 C T 3: 59,022,867 (GRCm39) V198M probably damaging Het
Pclo T A 5: 14,727,560 (GRCm39) D2139E unknown Het
Plxnb1 T A 9: 108,929,573 (GRCm39) V143E probably damaging Het
Prune2 G T 19: 17,097,357 (GRCm39) D954Y probably damaging Het
Qrsl1 G A 10: 43,760,749 (GRCm39) P278L probably damaging Het
Rnf17 C T 14: 56,724,479 (GRCm39) R1108C probably benign Het
Sipa1l2 T C 8: 126,145,907 (GRCm39) S1716G probably benign Het
Slfn4 A T 11: 83,079,831 (GRCm39) H507L probably benign Het
Snx18 T C 13: 113,753,685 (GRCm39) E416G probably damaging Het
Srp9 T C 1: 181,959,001 (GRCm39) V81A probably benign Het
Tex101 G A 7: 24,369,778 (GRCm39) T62M probably damaging Het
Utp25 G A 1: 192,802,671 (GRCm39) L349F probably benign Het
Wdfy4 G A 14: 32,826,072 (GRCm39) P1193L Het
Zbtb42 G T 12: 112,646,275 (GRCm39) C150F probably damaging Het
Other mutations in Chd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Chd5 APN 4 152,445,059 (GRCm39) missense probably damaging 1.00
IGL00886:Chd5 APN 4 152,444,156 (GRCm39) missense probably benign 0.00
IGL00963:Chd5 APN 4 152,467,395 (GRCm39) missense probably damaging 1.00
IGL01399:Chd5 APN 4 152,441,144 (GRCm39) missense probably damaging 1.00
IGL01571:Chd5 APN 4 152,468,572 (GRCm39) splice site probably benign
IGL01606:Chd5 APN 4 152,445,432 (GRCm39) missense probably damaging 0.99
IGL01636:Chd5 APN 4 152,469,110 (GRCm39) nonsense probably null
IGL02009:Chd5 APN 4 152,450,670 (GRCm39) missense probably damaging 1.00
IGL02417:Chd5 APN 4 152,451,751 (GRCm39) missense probably damaging 0.97
IGL02504:Chd5 APN 4 152,447,779 (GRCm39) missense probably damaging 0.99
IGL02508:Chd5 APN 4 152,447,481 (GRCm39) missense probably damaging 1.00
IGL02597:Chd5 APN 4 152,456,169 (GRCm39) missense probably damaging 1.00
IGL02608:Chd5 APN 4 152,440,564 (GRCm39) missense possibly damaging 0.94
IGL02612:Chd5 APN 4 152,445,033 (GRCm39) missense probably damaging 1.00
IGL02658:Chd5 APN 4 152,445,050 (GRCm39) missense probably damaging 1.00
IGL02662:Chd5 APN 4 152,456,588 (GRCm39) missense probably damaging 1.00
IGL02676:Chd5 APN 4 152,440,530 (GRCm39) splice site probably benign
IGL02871:Chd5 APN 4 152,461,142 (GRCm39) missense probably damaging 1.00
IGL02942:Chd5 APN 4 152,470,182 (GRCm39) missense probably damaging 0.98
IGL02956:Chd5 APN 4 152,464,413 (GRCm39) missense probably benign 0.00
IGL03286:Chd5 APN 4 152,469,952 (GRCm39) missense probably benign 0.00
IGL03348:Chd5 APN 4 152,461,142 (GRCm39) missense probably damaging 1.00
IGL03398:Chd5 APN 4 152,461,539 (GRCm39) missense probably damaging 0.97
PIT1430001:Chd5 UTSW 4 152,455,094 (GRCm39) missense probably damaging 1.00
PIT4151001:Chd5 UTSW 4 152,462,986 (GRCm39) missense probably damaging 0.99
R0079:Chd5 UTSW 4 152,470,206 (GRCm39) missense probably damaging 1.00
R0241:Chd5 UTSW 4 152,450,589 (GRCm39) missense probably damaging 1.00
R0241:Chd5 UTSW 4 152,450,589 (GRCm39) missense probably damaging 1.00
R0379:Chd5 UTSW 4 152,467,778 (GRCm39) missense probably benign 0.00
R0388:Chd5 UTSW 4 152,456,101 (GRCm39) missense probably damaging 1.00
R0675:Chd5 UTSW 4 152,470,407 (GRCm39) missense probably benign 0.06
R0730:Chd5 UTSW 4 152,432,441 (GRCm39) missense possibly damaging 0.72
R0799:Chd5 UTSW 4 152,468,616 (GRCm39) missense probably damaging 1.00
R0800:Chd5 UTSW 4 152,440,614 (GRCm39) missense probably damaging 1.00
R1276:Chd5 UTSW 4 152,463,191 (GRCm39) missense probably damaging 1.00
R1752:Chd5 UTSW 4 152,459,590 (GRCm39) missense probably damaging 1.00
R1753:Chd5 UTSW 4 152,463,272 (GRCm39) missense probably damaging 1.00
R1843:Chd5 UTSW 4 152,470,263 (GRCm39) missense probably damaging 1.00
R1850:Chd5 UTSW 4 152,454,990 (GRCm39) missense probably damaging 1.00
R1851:Chd5 UTSW 4 152,462,727 (GRCm39) missense probably damaging 0.97
R1859:Chd5 UTSW 4 152,464,980 (GRCm39) missense probably benign 0.00
R1983:Chd5 UTSW 4 152,469,123 (GRCm39) missense possibly damaging 0.89
R2404:Chd5 UTSW 4 152,451,791 (GRCm39) missense probably damaging 1.00
R2897:Chd5 UTSW 4 152,456,572 (GRCm39) missense probably damaging 1.00
R2898:Chd5 UTSW 4 152,456,572 (GRCm39) missense probably damaging 1.00
R3893:Chd5 UTSW 4 152,445,113 (GRCm39) missense probably damaging 1.00
R3938:Chd5 UTSW 4 152,461,512 (GRCm39) missense probably benign 0.05
R4707:Chd5 UTSW 4 152,445,039 (GRCm39) missense probably damaging 1.00
R4754:Chd5 UTSW 4 152,462,203 (GRCm39) missense probably damaging 0.99
R4911:Chd5 UTSW 4 152,445,129 (GRCm39) missense probably damaging 1.00
R4924:Chd5 UTSW 4 152,450,886 (GRCm39) missense possibly damaging 0.50
R4926:Chd5 UTSW 4 152,467,768 (GRCm39) missense probably benign 0.00
R5256:Chd5 UTSW 4 152,456,554 (GRCm39) missense probably benign 0.01
R5524:Chd5 UTSW 4 152,461,087 (GRCm39) missense probably benign
R5552:Chd5 UTSW 4 152,470,272 (GRCm39) missense possibly damaging 0.95
R5895:Chd5 UTSW 4 152,464,389 (GRCm39) missense probably benign 0.13
R5945:Chd5 UTSW 4 152,464,408 (GRCm39) missense probably benign
R6007:Chd5 UTSW 4 152,463,878 (GRCm39) missense probably null 1.00
R6039:Chd5 UTSW 4 152,438,078 (GRCm39) small deletion probably benign
R6039:Chd5 UTSW 4 152,438,078 (GRCm39) small deletion probably benign
R6172:Chd5 UTSW 4 152,463,848 (GRCm39) missense probably damaging 1.00
R6173:Chd5 UTSW 4 152,463,848 (GRCm39) missense probably damaging 1.00
R6323:Chd5 UTSW 4 152,451,791 (GRCm39) missense probably damaging 0.99
R6331:Chd5 UTSW 4 152,466,865 (GRCm39) missense probably benign 0.02
R6495:Chd5 UTSW 4 152,451,829 (GRCm39) missense probably damaging 1.00
R6528:Chd5 UTSW 4 152,441,133 (GRCm39) missense probably damaging 1.00
R6849:Chd5 UTSW 4 152,462,995 (GRCm39) missense probably damaging 1.00
R6854:Chd5 UTSW 4 152,467,395 (GRCm39) missense probably damaging 1.00
R6859:Chd5 UTSW 4 152,462,664 (GRCm39) missense probably damaging 1.00
R6999:Chd5 UTSW 4 152,458,891 (GRCm39) missense probably damaging 1.00
R7034:Chd5 UTSW 4 152,445,398 (GRCm39) missense possibly damaging 0.89
R7110:Chd5 UTSW 4 152,469,896 (GRCm39) missense probably damaging 1.00
R7361:Chd5 UTSW 4 152,447,745 (GRCm39) missense probably damaging 0.99
R7397:Chd5 UTSW 4 152,452,469 (GRCm39) missense possibly damaging 0.82
R7440:Chd5 UTSW 4 152,469,108 (GRCm39) missense probably benign 0.01
R7489:Chd5 UTSW 4 152,457,925 (GRCm39) missense probably damaging 1.00
R7810:Chd5 UTSW 4 152,443,032 (GRCm39) missense probably damaging 0.97
R8057:Chd5 UTSW 4 152,450,829 (GRCm39) missense probably damaging 1.00
R8078:Chd5 UTSW 4 152,445,448 (GRCm39) missense possibly damaging 0.90
R8170:Chd5 UTSW 4 152,461,040 (GRCm39) missense probably benign 0.26
R8255:Chd5 UTSW 4 152,463,880 (GRCm39) missense probably damaging 0.99
R8348:Chd5 UTSW 4 152,445,173 (GRCm39) missense probably damaging 0.98
R8448:Chd5 UTSW 4 152,445,173 (GRCm39) missense probably damaging 0.98
R8478:Chd5 UTSW 4 152,441,147 (GRCm39) nonsense probably null
R8482:Chd5 UTSW 4 152,441,147 (GRCm39) nonsense probably null
R8670:Chd5 UTSW 4 152,469,953 (GRCm39) missense possibly damaging 0.81
R8733:Chd5 UTSW 4 152,463,923 (GRCm39) missense probably damaging 1.00
R8743:Chd5 UTSW 4 152,450,862 (GRCm39) missense probably benign 0.03
R8941:Chd5 UTSW 4 152,463,305 (GRCm39) missense possibly damaging 0.82
R8961:Chd5 UTSW 4 152,467,489 (GRCm39) splice site probably benign
R9103:Chd5 UTSW 4 152,461,444 (GRCm39) missense possibly damaging 0.62
R9160:Chd5 UTSW 4 152,469,916 (GRCm39) missense probably damaging 0.99
R9221:Chd5 UTSW 4 152,456,122 (GRCm39) missense probably damaging 0.96
R9399:Chd5 UTSW 4 152,468,592 (GRCm39) missense probably benign 0.06
R9429:Chd5 UTSW 4 152,447,364 (GRCm39) missense probably damaging 0.99
R9635:Chd5 UTSW 4 152,461,079 (GRCm39) missense possibly damaging 0.87
R9783:Chd5 UTSW 4 152,458,865 (GRCm39) missense probably damaging 1.00
Z1176:Chd5 UTSW 4 152,462,936 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTCCTTACAGCCCAGGATG -3'
(R):5'- TGACAACCATGACCTCTCCAGG -3'

Sequencing Primer
(F):5'- AGGGTTTTCTCAGACTCAGGGAAC -3'
(R):5'- GACCTCTCCAGGCACCCTTAG -3'
Posted On 2020-06-30