Incidental Mutation 'R8096:Trim68'
ID630197
Institutional Source Beutler Lab
Gene Symbol Trim68
Ensembl Gene ENSMUSG00000073968
Gene Nametripartite motif-containing 68
SynonymsRnf137, F730114J12Rik, SS-56
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R8096 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location102677582-102687327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102678442 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 435 (S435P)
Ref Sequence ENSEMBL: ENSMUSP00000080813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082175] [ENSMUST00000210855]
Predicted Effect probably damaging
Transcript: ENSMUST00000082175
AA Change: S435P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080813
Gene: ENSMUSG00000073968
AA Change: S435P

DomainStartEndE-ValueType
RING 16 60 1.61e-8 SMART
BBOX 93 134 9.89e-9 SMART
coiled coil region 187 226 N/A INTRINSIC
PRY 302 354 1.91e-24 SMART
SPRY 355 482 3.03e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210855
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif-containing protein family, whose members are characterized by a "really interesting new gene" (RING) finger domain, a zinc-binding B-box motif, and a coiled-coil region. Members of this family function as E3 ubiquitin ligases and are involved in a broad range of biological processes. This gene regulates the activation of nuclear receptors, such as androgen receptor, and has been implicated in development of prostate cancer cells, where its expression increases in response to a downregulation of microRNAs. In addition, this gene participates in viral defense regulation as a negative regulator of interferon-beta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 G A 14: 54,645,269 A999V possibly damaging Het
Actn4 A G 7: 28,894,583 I833T possibly damaging Het
Actn4 C A 7: 28,901,913 R470L probably damaging Het
Adgre4 T A 17: 55,820,700 I580N probably damaging Het
Arid5b T A 10: 68,186,152 T203S probably benign Het
Astn1 A G 1: 158,609,320 Y824C probably damaging Het
Cacna2d3 A G 14: 29,103,700 V506A possibly damaging Het
Cdk17 T G 10: 93,216,367 M103R probably damaging Het
Clca3a1 T A 3: 144,749,685 E449V probably damaging Het
Cux2 A G 5: 121,869,097 Y834H possibly damaging Het
Dynlrb2 A G 8: 116,507,517 T7A possibly damaging Het
Ggcx G A 6: 72,429,993 R704Q probably benign Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpr87 A T 3: 59,179,808 L92Q possibly damaging Het
Grik1 C T 16: 88,006,467 G279E Het
Igsf10 G T 3: 59,328,959 T1267N probably damaging Het
Mrc2 G T 11: 105,343,507 R951L probably damaging Het
Muc4 T A 16: 32,755,390 S1755T unknown Het
Muc5b T C 7: 141,849,555 V751A unknown Het
Olfr1044 T A 2: 86,171,712 Y35F probably damaging Het
Olfr365 T A 2: 37,202,066 V275E probably damaging Het
Olfr518 A T 7: 108,881,041 C188* probably null Het
Pclo A G 5: 14,712,961 Y531C Het
Pigr A G 1: 130,846,510 E409G probably damaging Het
Rsph14 T A 10: 74,959,661 I231F possibly damaging Het
Ryr1 A G 7: 29,009,201 S4812P unknown Het
Scgb2b24 T A 7: 33,739,221 probably null Het
Scn2a T A 2: 65,764,022 H1738Q probably damaging Het
Scrib A T 15: 76,062,709 D678E probably benign Het
Slc39a8 T C 3: 135,884,656 F370S probably damaging Het
Sphkap A T 1: 83,277,558 D823E probably damaging Het
Srrm3 T A 5: 135,869,240 I555N unknown Het
Stx19 A C 16: 62,822,161 E113D possibly damaging Het
Tex30 A T 1: 44,088,503 Y91N probably damaging Het
Tnfsf13 A G 11: 69,685,157 C35R probably damaging Het
Tnik G A 3: 28,661,778 M1180I possibly damaging Het
Tnn C T 1: 160,122,841 A732T probably damaging Het
Tpra1 C T 6: 88,911,717 Q294* probably null Het
Trim24 G T 6: 37,958,657 S895I probably benign Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Zfp280d T C 9: 72,319,278 C335R probably damaging Het
Zfp958 G T 8: 4,613,273 probably benign Het
Other mutations in Trim68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Trim68 APN 7 102679141 splice site probably null
IGL02703:Trim68 APN 7 102684079 missense probably damaging 0.99
IGL02835:Trim68 UTSW 7 102678573 missense probably benign 0.21
R1765:Trim68 UTSW 7 102680390 missense possibly damaging 0.82
R1780:Trim68 UTSW 7 102684073 missense possibly damaging 0.58
R4107:Trim68 UTSW 7 102678451 missense probably benign 0.01
R4451:Trim68 UTSW 7 102684473 start codon destroyed probably damaging 1.00
R5385:Trim68 UTSW 7 102678783 missense probably damaging 1.00
R5793:Trim68 UTSW 7 102684353 missense possibly damaging 0.74
R5980:Trim68 UTSW 7 102678831 missense probably damaging 1.00
R6749:Trim68 UTSW 7 102678783 missense probably damaging 0.99
R6912:Trim68 UTSW 7 102684468 missense probably damaging 1.00
R7396:Trim68 UTSW 7 102678362 nonsense probably null
R7789:Trim68 UTSW 7 102684469 missense possibly damaging 0.61
R7892:Trim68 UTSW 7 102678797 missense unknown
X0067:Trim68 UTSW 7 102684132 missense probably benign 0.00
Z1176:Trim68 UTSW 7 102678813 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAAGCATCCTCCAACAATG -3'
(R):5'- ACAGATCTGAATGGGGTCTGGG -3'

Sequencing Primer
(F):5'- GATCTATTAAGTTAGGATGGCTCTCC -3'
(R):5'- AGTGTGTGTGGAAAATGTTGACC -3'
Posted On2020-06-30