Incidental Mutation 'R0702:Chd1l'
ID63044
Institutional Source Beutler Lab
Gene Symbol Chd1l
Ensembl Gene ENSMUSG00000028089
Gene Namechromodomain helicase DNA binding protein 1-like
Synonyms4432404A22Rik, Snf2p
MMRRC Submission 038885-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R0702 (G1)
Quality Score190
Status Not validated
Chromosome3
Chromosomal Location97560742-97610203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 97566794 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 791 (D791N)
Ref Sequence ENSEMBL: ENSMUSP00000029730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029730]
Predicted Effect probably benign
Transcript: ENSMUST00000029730
AA Change: D791N

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000029730
Gene: ENSMUSG00000028089
AA Change: D791N

DomainStartEndE-ValueType
DEXDc 36 224 1.83e-38 SMART
HELICc 371 453 7.45e-21 SMART
low complexity region 548 570 N/A INTRINSIC
coiled coil region 643 680 N/A INTRINSIC
low complexity region 692 709 N/A INTRINSIC
PDB:2FG1|A 718 878 6e-9 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197304
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA helicase protein involved in DNA repair. The protein converts ATP to add poly(ADP-ribose) as it regulates chromatin relaxation following DNA damage. Overexpression of this gene has been linked to several types of cancers. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 A T 8: 122,889,766 I2428N probably damaging Het
Ano9 A G 7: 141,107,282 V348A probably damaging Het
Cfap69 A G 5: 5,644,465 I132T probably benign Het
Chl1 A G 6: 103,706,622 Y819C probably damaging Het
Col5a2 T A 1: 45,380,131 D1263V possibly damaging Het
Csnk1g1 C T 9: 66,010,493 R45W probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dgat2l6 G A X: 100,542,681 V180M probably damaging Het
Fscb G A 12: 64,472,001 P897L unknown Het
Herc6 T C 6: 57,581,107 L24P probably damaging Het
Il23r T A 6: 67,466,285 Q278L probably damaging Het
Kpna4 A T 3: 69,084,105 V361D probably damaging Het
Muc1 A G 3: 89,230,220 D123G probably benign Het
Notch4 A G 17: 34,575,203 Y722C probably damaging Het
Ntng1 G C 3: 109,872,254 R336G probably damaging Het
Olfr199 T C 16: 59,215,699 M305V probably benign Het
Pgbd5 C T 8: 124,374,255 V421M probably benign Het
Prkdc A G 16: 15,785,971 T2950A possibly damaging Het
Proser3 A T 7: 30,539,530 D630E probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Serpina3g A G 12: 104,241,253 E225G probably damaging Het
Slc2a13 T C 15: 91,321,667 D439G probably benign Het
Srebf2 T C 15: 82,177,409 L352P probably damaging Het
Trpc5 A G X: 144,411,739 V590A probably damaging Het
Ubqln2 A T X: 153,499,669 M406L possibly damaging Het
Other mutations in Chd1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Chd1l APN 3 97590605 missense probably damaging 1.00
IGL01349:Chd1l APN 3 97591234 missense probably benign 0.07
IGL02115:Chd1l APN 3 97589904 critical splice donor site probably null
IGL02418:Chd1l APN 3 97581099 missense probably benign 0.39
IGL02717:Chd1l APN 3 97583907 missense probably damaging 1.00
IGL03091:Chd1l APN 3 97563547 missense probably damaging 1.00
IGL03048:Chd1l UTSW 3 97597763 missense probably benign 0.01
R0125:Chd1l UTSW 3 97587149 missense probably benign 0.00
R1226:Chd1l UTSW 3 97562625 nonsense probably null
R1237:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1238:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1239:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1301:Chd1l UTSW 3 97603648 splice site probably benign
R1366:Chd1l UTSW 3 97581149 missense probably damaging 0.99
R1444:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1445:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1500:Chd1l UTSW 3 97582805 missense probably benign 0.01
R1619:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1640:Chd1l UTSW 3 97580991 missense probably benign 0.00
R1762:Chd1l UTSW 3 97588299 missense probably damaging 1.00
R2291:Chd1l UTSW 3 97591283 missense probably damaging 1.00
R2444:Chd1l UTSW 3 97590566 missense probably damaging 1.00
R4008:Chd1l UTSW 3 97570402 missense probably benign 0.01
R4011:Chd1l UTSW 3 97570402 missense probably benign 0.01
R4106:Chd1l UTSW 3 97597703 missense probably benign 0.09
R4857:Chd1l UTSW 3 97572659 missense probably benign 0.27
R5008:Chd1l UTSW 3 97583908 missense probably damaging 1.00
R5337:Chd1l UTSW 3 97562616 missense probably damaging 1.00
R5844:Chd1l UTSW 3 97572567 missense probably benign 0.04
R6283:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6298:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6309:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6311:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6321:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6327:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6364:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6366:Chd1l UTSW 3 97594160 missense probably benign 0.00
R6467:Chd1l UTSW 3 97563533 missense probably damaging 0.97
R6483:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6493:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6494:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6585:Chd1l UTSW 3 97597772 missense probably damaging 0.96
R6925:Chd1l UTSW 3 97582826 missense probably damaging 1.00
R7148:Chd1l UTSW 3 97591316 missense probably damaging 1.00
R7244:Chd1l UTSW 3 97597750 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCTAACAAGCTACTGTGCTCCTG -3'
(R):5'- GAGGTGAAGTGCCACACCTAATCG -3'

Sequencing Primer
(F):5'- GCAGAGGCTGGGCAGTG -3'
(R):5'- ggaagtcaaggcaggagg -3'
Posted On2013-07-30