Incidental Mutation 'R0705:Dpy19l3'
ID63116
Institutional Source Beutler Lab
Gene Symbol Dpy19l3
Ensembl Gene ENSMUSG00000043671
Gene Namedpy-19-like 3 (C. elegans)
Synonyms
MMRRC Submission 038888-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R0705 (G1)
Quality Score97
Status Not validated
Chromosome7
Chromosomal Location35685165-35754454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35695316 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 599 (Y599F)
Ref Sequence ENSEMBL: ENSMUSP00000054747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051377] [ENSMUST00000143590]
Predicted Effect probably damaging
Transcript: ENSMUST00000051377
AA Change: Y599F

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000054747
Gene: ENSMUSG00000043671
AA Change: Y599F

DomainStartEndE-ValueType
Pfam:Dpy19 55 712 2.2e-243 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143590
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 A T 4: 58,885,366 probably null Het
Asic4 G T 1: 75,451,370 C180F probably damaging Het
Ccdc106 G A 7: 5,059,540 D11N possibly damaging Het
Crebbp A C 16: 4,155,010 S273R possibly damaging Het
Fam234b A T 6: 135,227,215 D452V probably benign Het
Fbxw22 G T 9: 109,403,096 H78N possibly damaging Het
Hpgd T C 8: 56,295,039 V65A probably damaging Het
Impg1 A T 9: 80,379,979 L395Q probably damaging Het
Kcnq5 A G 1: 21,535,177 M168T probably damaging Het
Spink5 T A 18: 43,992,274 M403K probably benign Het
Ssxb9 T G X: 8,371,783 S130R probably damaging Het
Other mutations in Dpy19l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Dpy19l3 APN 7 35692767 splice site probably benign
IGL01351:Dpy19l3 APN 7 35727415 splice site probably benign
IGL01622:Dpy19l3 APN 7 35722744 missense probably damaging 1.00
IGL01623:Dpy19l3 APN 7 35722744 missense probably damaging 1.00
IGL01645:Dpy19l3 APN 7 35695338 missense probably benign 0.00
IGL02725:Dpy19l3 APN 7 35711918 missense probably benign 0.01
IGL02817:Dpy19l3 APN 7 35692808 missense probably damaging 1.00
IGL03130:Dpy19l3 APN 7 35752672 missense probably benign 0.00
IGL03178:Dpy19l3 APN 7 35729729 nonsense probably null
IGL03374:Dpy19l3 APN 7 35712208 missense possibly damaging 0.82
R0143:Dpy19l3 UTSW 7 35714215 missense probably benign 0.19
R0164:Dpy19l3 UTSW 7 35716646 missense probably damaging 0.98
R0164:Dpy19l3 UTSW 7 35716646 missense probably damaging 0.98
R0385:Dpy19l3 UTSW 7 35752705 missense probably damaging 0.97
R1489:Dpy19l3 UTSW 7 35725410 nonsense probably null
R1640:Dpy19l3 UTSW 7 35749778 missense probably benign 0.41
R1782:Dpy19l3 UTSW 7 35708155 missense possibly damaging 0.94
R1843:Dpy19l3 UTSW 7 35729760 missense probably damaging 1.00
R2096:Dpy19l3 UTSW 7 35727288 critical splice donor site probably null
R3814:Dpy19l3 UTSW 7 35727292 nonsense probably null
R4438:Dpy19l3 UTSW 7 35692859 missense probably damaging 1.00
R4537:Dpy19l3 UTSW 7 35711901 missense probably benign 0.01
R4735:Dpy19l3 UTSW 7 35722721 missense probably benign 0.00
R4737:Dpy19l3 UTSW 7 35703501 missense probably damaging 1.00
R4864:Dpy19l3 UTSW 7 35712182 nonsense probably null
R4915:Dpy19l3 UTSW 7 35752742 utr 5 prime probably benign
R4920:Dpy19l3 UTSW 7 35708042 intron probably benign
R5300:Dpy19l3 UTSW 7 35727310 missense probably damaging 1.00
R5527:Dpy19l3 UTSW 7 35714130 missense possibly damaging 0.95
R5801:Dpy19l3 UTSW 7 35725298 missense probably benign 0.10
R6815:Dpy19l3 UTSW 7 35749847 missense possibly damaging 0.67
R7150:Dpy19l3 UTSW 7 35708630 missense probably benign
R7198:Dpy19l3 UTSW 7 35749765 missense possibly damaging 0.73
R7378:Dpy19l3 UTSW 7 35752642 missense probably benign 0.10
R7625:Dpy19l3 UTSW 7 35752681 missense probably benign
R7641:Dpy19l3 UTSW 7 35695309 missense probably damaging 1.00
R7674:Dpy19l3 UTSW 7 35695309 missense probably damaging 1.00
R8034:Dpy19l3 UTSW 7 35749856 missense probably benign
R8073:Dpy19l3 UTSW 7 35729748 missense probably damaging 1.00
R8183:Dpy19l3 UTSW 7 35695389 missense probably damaging 0.96
R8206:Dpy19l3 UTSW 7 35729730 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCAGGATTCGACAGCCCCATGC -3'
(R):5'- CTTCTCATTGGAGAGCTGGATGCC -3'

Sequencing Primer
(F):5'- GACAGCCCCATGCCCTTATG -3'
(R):5'- gggctacacgtaccatgag -3'
Posted On2013-07-30