Incidental Mutation 'R4920:Dpy19l3'
ID378514
Institutional Source Beutler Lab
Gene Symbol Dpy19l3
Ensembl Gene ENSMUSG00000043671
Gene Namedpy-19-like 3 (C. elegans)
Synonyms
MMRRC Submission 042522-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R4920 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location35685165-35754454 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 35708042 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051377] [ENSMUST00000143590]
Predicted Effect probably benign
Transcript: ENSMUST00000051377
SMART Domains Protein: ENSMUSP00000054747
Gene: ENSMUSG00000043671

DomainStartEndE-ValueType
Pfam:Dpy19 55 712 2.2e-243 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206004
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 87.9%
Validation Efficiency 96% (55/57)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092K14Rik A T 11: 114,199,045 noncoding transcript Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Apbb1ip A G 2: 22,819,684 D51G unknown Het
Arntl A G 7: 113,285,114 T120A probably damaging Het
Brca1 A T 11: 101,524,959 V783D probably damaging Het
Ccdc141 T C 2: 77,168,563 D58G probably damaging Het
Ccr9 G T 9: 123,779,439 G62V probably damaging Het
Ces2b T C 8: 104,836,906 Y422H probably benign Het
Cpa4 T C 6: 30,568,463 probably null Het
Dennd3 A G 15: 73,540,725 H412R probably benign Het
Dtwd2 G T 18: 49,698,440 R167S possibly damaging Het
Dync1i2 G A 2: 71,247,324 R243Q probably damaging Het
Ear2 G A 14: 44,103,125 G80E probably damaging Het
Fam171b A G 2: 83,880,359 K792E possibly damaging Het
Fam83b G A 9: 76,491,868 T651I probably benign Het
Fcrl5 T G 3: 87,444,173 F243V probably damaging Het
Galntl6 T C 8: 58,427,773 I115M probably damaging Het
Glrx3 A G 7: 137,464,130 D163G probably null Het
Gm13089 T C 4: 143,699,283 D30G probably benign Het
Gm14488 A T 2: 30,715,032 noncoding transcript Het
Gm973 T C 1: 59,627,566 S683P probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Gsdmd T C 15: 75,864,357 S112P probably damaging Het
Ighv14-3 A G 12: 114,060,257 V6A probably benign Het
Lca5l T A 16: 96,178,835 S32C probably damaging Het
Lrba T A 3: 86,664,458 Y260* probably null Het
Lyst T C 13: 13,647,060 S1340P possibly damaging Het
Mfsd13a T G 19: 46,367,216 F59V probably damaging Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Noa1 T C 5: 77,306,487 probably null Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Papd4 G A 13: 93,186,325 Q39* probably null Het
Pgm2 C T 4: 99,986,733 T571M probably damaging Het
Rfc1 C A 5: 65,287,928 V460F probably damaging Het
Rrn3 A G 16: 13,790,639 D182G probably benign Het
Sap25 T A 5: 137,642,245 probably benign Het
Slc9a2 A G 1: 40,755,718 I480V probably benign Het
Smo T C 6: 29,759,594 S642P probably damaging Het
Tbc1d22a A C 15: 86,311,748 I307L probably benign Het
Ubr3 A G 2: 69,952,868 Q716R probably benign Het
Vmn2r96 A G 17: 18,582,656 E276G probably benign Het
Zfp189 G A 4: 49,529,302 C135Y probably damaging Het
Other mutations in Dpy19l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Dpy19l3 APN 7 35692767 splice site probably benign
IGL01351:Dpy19l3 APN 7 35727415 splice site probably benign
IGL01622:Dpy19l3 APN 7 35722744 missense probably damaging 1.00
IGL01623:Dpy19l3 APN 7 35722744 missense probably damaging 1.00
IGL01645:Dpy19l3 APN 7 35695338 missense probably benign 0.00
IGL02725:Dpy19l3 APN 7 35711918 missense probably benign 0.01
IGL02817:Dpy19l3 APN 7 35692808 missense probably damaging 1.00
IGL03130:Dpy19l3 APN 7 35752672 missense probably benign 0.00
IGL03178:Dpy19l3 APN 7 35729729 nonsense probably null
IGL03374:Dpy19l3 APN 7 35712208 missense possibly damaging 0.82
R0143:Dpy19l3 UTSW 7 35714215 missense probably benign 0.19
R0164:Dpy19l3 UTSW 7 35716646 missense probably damaging 0.98
R0164:Dpy19l3 UTSW 7 35716646 missense probably damaging 0.98
R0385:Dpy19l3 UTSW 7 35752705 missense probably damaging 0.97
R0705:Dpy19l3 UTSW 7 35695316 missense probably damaging 0.96
R1489:Dpy19l3 UTSW 7 35725410 nonsense probably null
R1640:Dpy19l3 UTSW 7 35749778 missense probably benign 0.41
R1782:Dpy19l3 UTSW 7 35708155 missense possibly damaging 0.94
R1843:Dpy19l3 UTSW 7 35729760 missense probably damaging 1.00
R2096:Dpy19l3 UTSW 7 35727288 critical splice donor site probably null
R3814:Dpy19l3 UTSW 7 35727292 nonsense probably null
R4438:Dpy19l3 UTSW 7 35692859 missense probably damaging 1.00
R4537:Dpy19l3 UTSW 7 35711901 missense probably benign 0.01
R4735:Dpy19l3 UTSW 7 35722721 missense probably benign 0.00
R4737:Dpy19l3 UTSW 7 35703501 missense probably damaging 1.00
R4864:Dpy19l3 UTSW 7 35712182 nonsense probably null
R4915:Dpy19l3 UTSW 7 35752742 utr 5 prime probably benign
R5300:Dpy19l3 UTSW 7 35727310 missense probably damaging 1.00
R5527:Dpy19l3 UTSW 7 35714130 missense possibly damaging 0.95
R5801:Dpy19l3 UTSW 7 35725298 missense probably benign 0.10
R6815:Dpy19l3 UTSW 7 35749847 missense possibly damaging 0.67
R7150:Dpy19l3 UTSW 7 35708630 missense probably benign
R7198:Dpy19l3 UTSW 7 35749765 missense possibly damaging 0.73
R7378:Dpy19l3 UTSW 7 35752642 missense probably benign 0.10
R7625:Dpy19l3 UTSW 7 35752681 missense probably benign
R7641:Dpy19l3 UTSW 7 35695309 missense probably damaging 1.00
R7674:Dpy19l3 UTSW 7 35695309 missense probably damaging 1.00
R8034:Dpy19l3 UTSW 7 35749856 missense probably benign
R8073:Dpy19l3 UTSW 7 35729748 missense probably damaging 1.00
R8183:Dpy19l3 UTSW 7 35695389 missense probably damaging 0.96
R8206:Dpy19l3 UTSW 7 35729730 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACGCCAGAGAGTGTCTTATAC -3'
(R):5'- AGGTCTTCGCACAAGCACTG -3'

Sequencing Primer
(F):5'- CTCTGTGACAGACTGTGACCTG -3'
(R):5'- GCACAAGCACTGACCTGTG -3'
Posted On2016-04-15