Incidental Mutation 'R7198:Dpy19l3'
ID560079
Institutional Source Beutler Lab
Gene Symbol Dpy19l3
Ensembl Gene ENSMUSG00000043671
Gene Namedpy-19-like 3 (C. elegans)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R7198 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location35685165-35754454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35749765 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 71 (N71S)
Ref Sequence ENSEMBL: ENSMUSP00000054747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051377]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051377
AA Change: N71S

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000054747
Gene: ENSMUSG00000043671
AA Change: N71S

DomainStartEndE-ValueType
Pfam:Dpy19 55 712 2.2e-243 PFAM
Meta Mutation Damage Score 0.1803 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a C T 11: 110,078,655 S365N probably damaging Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Baz2b A G 2: 59,962,206 L526P probably benign Het
Bbs1 A T 19: 4,895,015 L376Q probably damaging Het
Bcl9 T A 3: 97,205,195 M1315L possibly damaging Het
Bcl9 T C 3: 97,208,867 Q837R probably damaging Het
Cct2 A G 10: 117,053,124 V490A probably benign Het
Cdh23 T C 10: 60,312,599 Y2663C possibly damaging Het
Chit1 A G 1: 134,150,491 K346E possibly damaging Het
Chl1 A G 6: 103,706,556 Y781C probably damaging Het
Col12a1 A C 9: 79,650,032 L1938R possibly damaging Het
Cpxm2 T A 7: 132,080,084 N239Y probably damaging Het
Cyp3a41b A G 5: 145,582,520 Y54H probably benign Het
Dclk1 A C 3: 55,477,875 D369A possibly damaging Het
Fer T A 17: 63,921,688 V186E possibly damaging Het
Gm11042 T A 12: 74,315,114 H39L unknown Het
Gm11639 T A 11: 104,751,885 N1111K probably benign Het
Gm14325 A G 2: 177,832,005 I428T probably benign Het
Gm47995 A G 1: 151,198,653 E69G possibly damaging Het
Gm6176 T A 7: 22,051,171 I112F probably damaging Het
Hivep2 T A 10: 14,129,966 D769E probably benign Het
Hsdl1 C T 8: 119,567,868 V40I probably benign Het
Ipmk A G 10: 71,348,052 H34R probably damaging Het
Kcnd3 T C 3: 105,459,540 L242P probably damaging Het
Kdm4d T C 9: 14,464,020 M181V probably damaging Het
Lats2 A T 14: 57,697,125 I716N probably damaging Het
Liph T C 16: 21,966,022 Y305C probably damaging Het
Ltbp1 T C 17: 75,226,967 V150A possibly damaging Het
Ly6d A T 15: 74,762,535 S69T probably benign Het
Meltf A G 16: 31,883,799 R115G possibly damaging Het
Msgn1 G T 12: 11,208,901 D16E probably benign Het
Mthfd2l T A 5: 90,946,846 I58K probably damaging Het
Mup18 G C 4: 61,673,336 probably null Het
Nek10 T A 14: 14,850,947 W331R probably damaging Het
Nphp3 A G 9: 104,004,775 Y148C probably damaging Het
Olfr1256 T C 2: 89,835,732 Y71C probably damaging Het
Olfr187 C T 16: 59,036,093 V215I probably benign Het
Olfr820 T A 10: 130,017,891 C177S probably damaging Het
Oscp1 A G 4: 126,086,666 T325A possibly damaging Het
Pcdha4 T A 18: 36,953,560 N265K probably damaging Het
Pigq C T 17: 25,934,225 V331I probably benign Het
Plekhg4 A G 8: 105,378,697 E598G probably damaging Het
Pou6f2 G A 13: 18,129,163 T120M probably damaging Het
Psg27 T A 7: 18,561,801 T240S probably damaging Het
Samd12 T A 15: 53,860,253 I15F probably damaging Het
Scaf4 A T 16: 90,252,430 D256E unknown Het
Scaf8 T A 17: 3,163,098 M154K unknown Het
Slc27a1 T C 8: 71,579,427 V64A possibly damaging Het
Smc5 G A 19: 23,259,700 R256* probably null Het
Snx31 A G 15: 36,555,310 F31L probably benign Het
Spag17 T C 3: 100,095,572 S1871P probably benign Het
Tdpoz4 T G 3: 93,797,355 S320A probably benign Het
Tmprss11c A T 5: 86,231,832 C406S probably damaging Het
Tnip1 G A 11: 54,917,804 A519V probably benign Het
Tssc4 T A 7: 143,070,987 probably null Het
Uba3 A T 6: 97,205,551 M1K probably null Het
Usp32 GAACAAGTCCACAACAA GAACAA 11: 85,022,855 probably null Het
Wdr78 A G 4: 103,062,413 V498A probably damaging Het
Wnt11 T C 7: 98,847,381 M176T possibly damaging Het
Wrn C T 8: 33,324,318 G366D probably benign Het
Xylt1 T A 7: 117,656,584 I793N probably damaging Het
Zfp677 T G 17: 21,398,417 C579G probably damaging Het
Zscan4-ps1 T A 7: 11,065,699 K421M probably damaging Het
Other mutations in Dpy19l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Dpy19l3 APN 7 35692767 splice site probably benign
IGL01351:Dpy19l3 APN 7 35727415 splice site probably benign
IGL01622:Dpy19l3 APN 7 35722744 missense probably damaging 1.00
IGL01623:Dpy19l3 APN 7 35722744 missense probably damaging 1.00
IGL01645:Dpy19l3 APN 7 35695338 missense probably benign 0.00
IGL02725:Dpy19l3 APN 7 35711918 missense probably benign 0.01
IGL02817:Dpy19l3 APN 7 35692808 missense probably damaging 1.00
IGL03130:Dpy19l3 APN 7 35752672 missense probably benign 0.00
IGL03178:Dpy19l3 APN 7 35729729 nonsense probably null
IGL03374:Dpy19l3 APN 7 35712208 missense possibly damaging 0.82
R0143:Dpy19l3 UTSW 7 35714215 missense probably benign 0.19
R0164:Dpy19l3 UTSW 7 35716646 missense probably damaging 0.98
R0164:Dpy19l3 UTSW 7 35716646 missense probably damaging 0.98
R0385:Dpy19l3 UTSW 7 35752705 missense probably damaging 0.97
R0705:Dpy19l3 UTSW 7 35695316 missense probably damaging 0.96
R1489:Dpy19l3 UTSW 7 35725410 nonsense probably null
R1640:Dpy19l3 UTSW 7 35749778 missense probably benign 0.41
R1782:Dpy19l3 UTSW 7 35708155 missense possibly damaging 0.94
R1843:Dpy19l3 UTSW 7 35729760 missense probably damaging 1.00
R2096:Dpy19l3 UTSW 7 35727288 critical splice donor site probably null
R3814:Dpy19l3 UTSW 7 35727292 nonsense probably null
R4438:Dpy19l3 UTSW 7 35692859 missense probably damaging 1.00
R4537:Dpy19l3 UTSW 7 35711901 missense probably benign 0.01
R4735:Dpy19l3 UTSW 7 35722721 missense probably benign 0.00
R4737:Dpy19l3 UTSW 7 35703501 missense probably damaging 1.00
R4864:Dpy19l3 UTSW 7 35712182 nonsense probably null
R4915:Dpy19l3 UTSW 7 35752742 utr 5 prime probably benign
R4920:Dpy19l3 UTSW 7 35708042 intron probably benign
R5300:Dpy19l3 UTSW 7 35727310 missense probably damaging 1.00
R5527:Dpy19l3 UTSW 7 35714130 missense possibly damaging 0.95
R5801:Dpy19l3 UTSW 7 35725298 missense probably benign 0.10
R6815:Dpy19l3 UTSW 7 35749847 missense possibly damaging 0.67
R7150:Dpy19l3 UTSW 7 35708630 missense probably benign
R7378:Dpy19l3 UTSW 7 35752642 missense probably benign 0.10
R7625:Dpy19l3 UTSW 7 35752681 missense probably benign
R7641:Dpy19l3 UTSW 7 35695309 missense probably damaging 1.00
R7674:Dpy19l3 UTSW 7 35695309 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTCAAACTCTTTCAAGATCCTGG -3'
(R):5'- GCGCATGTCTTCTGATTTATGC -3'

Sequencing Primer
(F):5'- AGGCAGACCTCTGAATGTCTGATC -3'
(R):5'- TGTGTAGGTTGTACAAATGAGCACC -3'
Posted On2019-06-26