Incidental Mutation 'R8289:Ncoa5'
ID638556
Institutional Source Beutler Lab
Gene Symbol Ncoa5
Ensembl Gene ENSMUSG00000039804
Gene Namenuclear receptor coactivator 5
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8289 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location165000357-165034867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 165013062 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 47 (D47N)
Ref Sequence ENSEMBL: ENSMUSP00000046388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040381] [ENSMUST00000121377] [ENSMUST00000122070] [ENSMUST00000153905]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040381
AA Change: D47N

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046388
Gene: ENSMUSG00000039804
AA Change: D47N

DomainStartEndE-ValueType
low complexity region 46 79 N/A INTRINSIC
low complexity region 82 104 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
coiled coil region 163 190 N/A INTRINSIC
SCOP:d1kmma1 195 287 2e-9 SMART
PDB:1V95|A 197 314 3e-79 PDB
low complexity region 324 340 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 395 427 N/A INTRINSIC
low complexity region 440 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121377
SMART Domains Protein: ENSMUSP00000113872
Gene: ENSMUSG00000039804

DomainStartEndE-ValueType
PDB:1V95|A 1 34 2e-15 PDB
low complexity region 44 60 N/A INTRINSIC
low complexity region 87 96 N/A INTRINSIC
low complexity region 115 147 N/A INTRINSIC
low complexity region 160 180 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000122070
AA Change: D47N
SMART Domains Protein: ENSMUSP00000113166
Gene: ENSMUSG00000039804
AA Change: D47N

DomainStartEndE-ValueType
low complexity region 46 79 N/A INTRINSIC
low complexity region 82 104 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
coiled coil region 163 190 N/A INTRINSIC
SCOP:d1kmma1 195 287 1e-8 SMART
PDB:1V95|A 197 314 2e-80 PDB
low complexity region 324 340 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000153905
AA Change: D47N

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116778
Gene: ENSMUSG00000039804
AA Change: D47N

DomainStartEndE-ValueType
low complexity region 46 68 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coregulator for the alpha and beta estrogen receptors and the orphan nuclear receptor NR1D2. The protein localizes to the nucleus, and is thought to have both coactivator and corepressor functions. Its interaction with nuclear receptors is independent of the AF2 domain on the receptors, which is known to regulate interaction with other coreceptors. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2017]
PHENOTYPE: Male mice heterozygous for a knock-out allele exhibit infertility, impaired glucose homeostasis, liver dysplasia and HCC. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 C A 5: 89,775,423 D175Y possibly damaging Het
Adra1b G A 11: 43,835,488 P201S probably damaging Het
Ahnak2 A G 12: 112,775,808 V610A possibly damaging Het
Ap5s1 A C 2: 131,212,459 H62P probably benign Het
Apeh A G 9: 108,086,245 S593P probably damaging Het
Arhgap24 T C 5: 102,880,826 V289A possibly damaging Het
Atoh1 A G 6: 64,729,909 E196G probably damaging Het
Atp1b3 G A 9: 96,333,549 S271L probably benign Het
Atp6v0a1 A G 11: 101,034,105 R339G probably damaging Het
Calb2 T C 8: 110,168,058 H27R possibly damaging Het
Camkk2 A C 5: 122,756,626 L201R probably damaging Het
Car15 A G 16: 17,836,716 probably null Het
Cecr2 A G 6: 120,758,116 N771S probably benign Het
Cecr6 A T 6: 120,492,761 S332T possibly damaging Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Csmd1 T A 8: 16,058,702 I1896F probably damaging Het
Cubn C T 2: 13,486,802 V145I probably benign Het
Cuedc1 G A 11: 88,182,555 S182N probably benign Het
Cux1 T A 5: 136,308,504 E718V probably damaging Het
Cyp7a1 G A 4: 6,268,295 P477S probably damaging Het
Dcaf17 T A 2: 71,055,374 W16R Het
Dhx8 T A 11: 101,740,745 M388K probably benign Het
Dnah14 T A 1: 181,716,215 Y2453* probably null Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
F830016B08Rik G A 18: 60,300,288 E148K probably benign Het
Gm15800 A G 5: 121,266,361 T434A possibly damaging Het
Gm4955 T C 1: 173,480,466 I655V Het
Ide A G 19: 37,313,553 L368P Het
Ide G C 19: 37,313,554 L368V probably null Het
Insrr A G 3: 87,814,194 M1136V probably damaging Het
Kcne2 A G 16: 92,296,819 E78G probably damaging Het
Lrrc23 A T 6: 124,778,304 L90H probably damaging Het
Magel2 A C 7: 62,379,127 Q593P unknown Het
Mrgpra3 G A 7: 47,589,720 H153Y possibly damaging Het
Msln A G 17: 25,748,906 V595A possibly damaging Het
Mvb12a T C 8: 71,543,059 probably null Het
Myo7a T G 7: 98,077,169 M966L probably benign Het
Neurl4 T A 11: 69,909,380 probably null Het
Olfr389 T A 11: 73,777,013 M105L probably benign Het
Olfr464 T C 11: 87,914,763 T48A probably benign Het
Olfr501-ps1 T A 7: 108,508,918 H287Q unknown Het
Olfr884 T A 9: 38,047,704 C161S probably benign Het
Osbpl7 T A 11: 97,056,579 S480T probably benign Het
Podnl1 T C 8: 84,131,923 L484P Het
Prkaa1 G T 15: 5,177,082 V438L possibly damaging Het
Prune2 A T 19: 17,123,009 H1959L probably benign Het
Rad50 A T 11: 53,698,858 L172* probably null Het
Samsn1 C A 16: 75,888,796 G25W probably damaging Het
Sbno1 T G 5: 124,404,005 L362F probably damaging Het
Slc26a6 G A 9: 108,856,031 R43H probably benign Het
Slc35f5 T G 1: 125,562,515 Y49* probably null Het
Slc41a2 T C 10: 83,301,180 I288V probably benign Het
Slc9c1 A G 16: 45,582,981 M804V probably benign Het
Smc6 T A 12: 11,274,051 S66T probably benign Het
Ssh1 T C 5: 113,942,384 D995G probably benign Het
Sycp1 A G 3: 102,841,037 I813T probably benign Het
Treml4 A C 17: 48,274,428 I244L probably benign Het
Unc13b T A 4: 43,172,524 C1117* probably null Het
Wdr35 A G 12: 9,008,020 I526V probably benign Het
Zap70 T C 1: 36,781,137 W500R probably damaging Het
Zfr G T 15: 12,135,271 V49F noncoding transcript Het
Other mutations in Ncoa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02285:Ncoa5 APN 2 165002840 missense probably damaging 1.00
IGL02624:Ncoa5 APN 2 165013061 missense probably damaging 0.99
R0383:Ncoa5 UTSW 2 165009390 missense possibly damaging 0.67
R0835:Ncoa5 UTSW 2 165002794 missense probably damaging 1.00
R1667:Ncoa5 UTSW 2 165001703 missense probably damaging 1.00
R2110:Ncoa5 UTSW 2 165012918 missense possibly damaging 0.59
R4887:Ncoa5 UTSW 2 165002150 missense probably damaging 1.00
R5100:Ncoa5 UTSW 2 165009389 missense probably damaging 0.99
R5631:Ncoa5 UTSW 2 165013121 missense possibly damaging 0.90
R6616:Ncoa5 UTSW 2 165010563 nonsense probably null
R6737:Ncoa5 UTSW 2 165002135 missense probably damaging 1.00
R7015:Ncoa5 UTSW 2 165002081 missense probably benign 0.02
R7567:Ncoa5 UTSW 2 165004251 missense possibly damaging 0.83
R7840:Ncoa5 UTSW 2 165012896 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- ACCTGTACAAAGGGTCTCTGG -3'
(R):5'- CTCTTATACAGAGCTGAAGGGTTGG -3'

Sequencing Primer
(F):5'- GTCATACACAGGGTCTCGATGATC -3'
(R):5'- AGCTGAAGGGTTGGCTACC -3'
Posted On2020-07-28