Incidental Mutation 'R8289:Insrr'
ID 638557
Institutional Source Beutler Lab
Gene Symbol Insrr
Ensembl Gene ENSMUSG00000005640
Gene Name insulin receptor-related receptor
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock # R8289 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 87796951-87816101 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87814194 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 1136 (M1136V)
Ref Sequence ENSEMBL: ENSMUSP00000029711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029711] [ENSMUST00000029714] [ENSMUST00000090981] [ENSMUST00000107582]
AlphaFold Q9WTL4
Predicted Effect probably damaging
Transcript: ENSMUST00000029711
AA Change: M1136V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029711
Gene: ENSMUSG00000005640
AA Change: M1136V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 1.8e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 3.8e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029714
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090981
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107582
AA Change: M1136V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103208
Gene: ENSMUSG00000005640
AA Change: M1136V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 7.7e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 1.6e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no anomalies in pancreatic islet morphology, beta-cell mass or pancreatic secretory function. This mutation in combination with Insr mutant mice does not affect the diabetes predisposition of Insr mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a G C 11: 110,036,689 probably benign Het
Adamts3 C A 5: 89,775,423 D175Y possibly damaging Het
Adra1b G A 11: 43,835,488 P201S probably damaging Het
Ahnak2 A G 12: 112,775,808 V610A possibly damaging Het
Ap5s1 A C 2: 131,212,459 H62P probably benign Het
Apeh A G 9: 108,086,245 S593P probably damaging Het
Arhgap24 T C 5: 102,880,826 V289A possibly damaging Het
Atoh1 A G 6: 64,729,909 E196G probably damaging Het
Atp1b3 G A 9: 96,333,549 S271L probably benign Het
Atp6v0a1 A G 11: 101,034,105 R339G probably damaging Het
Calb2 T C 8: 110,168,058 H27R possibly damaging Het
Camkk2 A C 5: 122,756,626 L201R probably damaging Het
Car15 A G 16: 17,836,716 probably null Het
Cecr2 A G 6: 120,758,116 N771S probably benign Het
Cecr6 A T 6: 120,492,761 S332T possibly damaging Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Csmd1 T A 8: 16,058,702 I1896F probably damaging Het
Cubn C T 2: 13,486,802 V145I probably benign Het
Cuedc1 G A 11: 88,182,555 S182N probably benign Het
Cux1 T A 5: 136,308,504 E718V probably damaging Het
Cyp7a1 G A 4: 6,268,295 P477S probably damaging Het
Dcaf17 T A 2: 71,055,374 W16R Het
Dhx8 T A 11: 101,740,745 M388K probably benign Het
Dnah14 T A 1: 181,716,215 Y2453* probably null Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
F830016B08Rik G A 18: 60,300,288 E148K probably benign Het
Gm15800 A G 5: 121,266,361 T434A possibly damaging Het
Gm4955 T C 1: 173,480,466 I655V Het
Ide A G 19: 37,313,553 L368P Het
Ide G C 19: 37,313,554 L368V probably null Het
Kcne2 A G 16: 92,296,819 E78G probably damaging Het
Lrrc23 A T 6: 124,778,304 L90H probably damaging Het
Magel2 A C 7: 62,379,127 Q593P unknown Het
Mrgpra3 G A 7: 47,589,720 H153Y possibly damaging Het
Msln A G 17: 25,748,906 V595A possibly damaging Het
Mvb12a T C 8: 71,543,059 probably null Het
Myo7a T G 7: 98,077,169 M966L probably benign Het
Ncoa5 C T 2: 165,013,062 D47N possibly damaging Het
Neurl4 T A 11: 69,909,380 probably null Het
Olfr389 T A 11: 73,777,013 M105L probably benign Het
Olfr464 T C 11: 87,914,763 T48A probably benign Het
Olfr501-ps1 T A 7: 108,508,918 H287Q unknown Het
Olfr884 T A 9: 38,047,704 C161S probably benign Het
Osbpl7 T A 11: 97,056,579 S480T probably benign Het
Podnl1 T C 8: 84,131,923 L484P Het
Polr3gl G T 3: 96,581,912 probably benign Het
Prkaa1 G T 15: 5,177,082 V438L possibly damaging Het
Prune2 A T 19: 17,123,009 H1959L probably benign Het
Rad50 A T 11: 53,698,858 L172* probably null Het
Samsn1 C A 16: 75,888,796 G25W probably damaging Het
Sbno1 T G 5: 124,404,005 L362F probably damaging Het
Slc26a6 G A 9: 108,856,031 R43H probably benign Het
Slc35f5 T G 1: 125,562,515 Y49* probably null Het
Slc41a2 T C 10: 83,301,180 I288V probably benign Het
Slc9c1 A G 16: 45,582,981 M804V probably benign Het
Smc6 T A 12: 11,274,051 S66T probably benign Het
Ssh1 T C 5: 113,942,384 D995G probably benign Het
Stk11 G T 10: 80,125,906 probably benign Het
Sycp1 A G 3: 102,841,037 I813T probably benign Het
Treml4 A C 17: 48,274,428 I244L probably benign Het
Unc13b T A 4: 43,172,524 C1117* probably null Het
Wdr35 A G 12: 9,008,020 I526V probably benign Het
Zap70 T C 1: 36,781,137 W500R probably damaging Het
Zfr G T 15: 12,135,271 V49F noncoding transcript Het
Other mutations in Insrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Insrr APN 3 87813674 critical splice donor site probably null
IGL00801:Insrr APN 3 87813808 missense probably damaging 1.00
IGL01628:Insrr APN 3 87800792 nonsense probably null
IGL01755:Insrr APN 3 87814186 missense probably damaging 1.00
IGL02100:Insrr APN 3 87811620 missense probably damaging 1.00
IGL02261:Insrr APN 3 87800722 missense probably damaging 1.00
IGL02366:Insrr APN 3 87809909 missense possibly damaging 0.91
IGL02387:Insrr APN 3 87813127 missense probably damaging 1.00
IGL02478:Insrr APN 3 87809412 missense probably benign 0.14
IGL02550:Insrr APN 3 87804498 missense probably damaging 1.00
IGL02555:Insrr APN 3 87813817 missense probably damaging 0.99
IGL02673:Insrr APN 3 87813061 missense possibly damaging 0.95
IGL02724:Insrr APN 3 87809572 missense probably benign 0.31
IGL02798:Insrr APN 3 87810517 missense probably damaging 1.00
IGL02969:Insrr APN 3 87814191 nonsense probably null
IGL03073:Insrr APN 3 87809938 splice site probably benign
IGL03178:Insrr APN 3 87802541 splice site probably null
IGL03389:Insrr APN 3 87808731 missense probably damaging 1.00
IGL03399:Insrr APN 3 87809331 missense probably null 0.99
IGL02799:Insrr UTSW 3 87813581 missense probably damaging 1.00
R0011:Insrr UTSW 3 87809616 missense possibly damaging 0.86
R0053:Insrr UTSW 3 87800452 missense probably damaging 1.00
R0053:Insrr UTSW 3 87800452 missense probably damaging 1.00
R0357:Insrr UTSW 3 87808646 splice site probably null
R0501:Insrr UTSW 3 87810684 missense probably benign 0.12
R0504:Insrr UTSW 3 87813156 missense possibly damaging 0.69
R0522:Insrr UTSW 3 87800872 missense probably damaging 1.00
R0555:Insrr UTSW 3 87814437 splice site probably benign
R0558:Insrr UTSW 3 87810981 missense possibly damaging 0.77
R0599:Insrr UTSW 3 87813133 missense probably damaging 0.97
R1312:Insrr UTSW 3 87800490 missense probably damaging 1.00
R1694:Insrr UTSW 3 87804062 missense probably benign
R1785:Insrr UTSW 3 87810572 splice site probably null
R1786:Insrr UTSW 3 87810572 splice site probably null
R1892:Insrr UTSW 3 87813877 missense probably damaging 1.00
R1950:Insrr UTSW 3 87814513 missense probably damaging 1.00
R2080:Insrr UTSW 3 87814291 missense possibly damaging 0.79
R2094:Insrr UTSW 3 87803181 missense probably damaging 1.00
R2130:Insrr UTSW 3 87810572 splice site probably null
R2131:Insrr UTSW 3 87810572 splice site probably null
R2133:Insrr UTSW 3 87810572 splice site probably null
R2220:Insrr UTSW 3 87809418 missense probably damaging 1.00
R2259:Insrr UTSW 3 87800452 missense probably damaging 1.00
R2404:Insrr UTSW 3 87802667 missense possibly damaging 0.71
R4027:Insrr UTSW 3 87809599 missense probably benign
R4042:Insrr UTSW 3 87813827 missense probably damaging 1.00
R4510:Insrr UTSW 3 87808671 missense possibly damaging 0.67
R4511:Insrr UTSW 3 87808671 missense possibly damaging 0.67
R4571:Insrr UTSW 3 87800887 missense probably benign
R4870:Insrr UTSW 3 87811604 missense probably damaging 1.00
R5057:Insrr UTSW 3 87815265 missense probably benign 0.00
R5393:Insrr UTSW 3 87810700 splice site probably null
R5685:Insrr UTSW 3 87800496 splice site probably null
R6039:Insrr UTSW 3 87809301 missense possibly damaging 0.56
R6039:Insrr UTSW 3 87809301 missense possibly damaging 0.56
R6047:Insrr UTSW 3 87804176 missense probably damaging 1.00
R6276:Insrr UTSW 3 87800519 nonsense probably null
R6298:Insrr UTSW 3 87812965 missense probably damaging 1.00
R6726:Insrr UTSW 3 87813566 missense probably damaging 1.00
R6727:Insrr UTSW 3 87813566 missense probably damaging 1.00
R6728:Insrr UTSW 3 87813566 missense probably damaging 1.00
R6796:Insrr UTSW 3 87813566 missense probably damaging 1.00
R7041:Insrr UTSW 3 87815244 missense probably damaging 1.00
R7169:Insrr UTSW 3 87808594 missense probably benign 0.15
R7270:Insrr UTSW 3 87803133 missense probably damaging 1.00
R7340:Insrr UTSW 3 87814316 critical splice donor site probably null
R7398:Insrr UTSW 3 87808732 missense probably damaging 1.00
R7473:Insrr UTSW 3 87804531 splice site probably null
R7815:Insrr UTSW 3 87808695 missense probably damaging 0.98
R8159:Insrr UTSW 3 87800428 missense probably damaging 1.00
R8309:Insrr UTSW 3 87810442 missense probably benign 0.00
R8312:Insrr UTSW 3 87800484 missense possibly damaging 0.93
R8445:Insrr UTSW 3 87813584 missense probably damaging 1.00
R8917:Insrr UTSW 3 87810969 missense probably benign 0.00
R8960:Insrr UTSW 3 87813079 missense probably damaging 1.00
R8989:Insrr UTSW 3 87815357 missense probably damaging 0.96
R9015:Insrr UTSW 3 87813603 missense probably damaging 1.00
R9202:Insrr UTSW 3 87813120 missense probably damaging 1.00
R9251:Insrr UTSW 3 87810084 missense probably benign 0.08
R9327:Insrr UTSW 3 87814297 missense probably damaging 1.00
RF022:Insrr UTSW 3 87804485 missense possibly damaging 0.51
Z1177:Insrr UTSW 3 87800827 missense possibly damaging 0.91
Z1192:Insrr UTSW 3 87802579 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTAGAGAGCCTCCCTAAG -3'
(R):5'- TTCCAGGCCCTTTCCAGATG -3'

Sequencing Primer
(F):5'- GTAGAGAGCCTCCCTAAGCCATAG -3'
(R):5'- TTTCCAGATGCCGCTGC -3'
Posted On 2020-07-28