Incidental Mutation 'R8295:Card6'
ID638903
Institutional Source Beutler Lab
Gene Symbol Card6
Ensembl Gene ENSMUSG00000041849
Gene Namecaspase recruitment domain family, member 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8295 (G1)
Quality Score210.458
Status Not validated
Chromosome15
Chromosomal Location5095981-5108539 bp(-) (GRCm38)
Type of Mutationsmall deletion (10 aa in frame mutation)
DNA Base Change (assembly) TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG to TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG at 5098691 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118365]
Predicted Effect probably benign
Transcript: ENSMUST00000118365
SMART Domains Protein: ENSMUSP00000112833
Gene: ENSMUSG00000041849

DomainStartEndE-ValueType
CARD 3 89 2.13e-5 SMART
low complexity region 237 245 N/A INTRINSIC
low complexity region 257 273 N/A INTRINSIC
Blast:PGAM 278 656 7e-45 BLAST
low complexity region 919 935 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
internal_repeat_1 962 1041 6.5e-13 PROSPERO
internal_repeat_1 1039 1101 6.5e-13 PROSPERO
low complexity region 1107 1132 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a caspase recruitment domain (CARD), an antiparallel six-helical bundle that mediates homotypic protein-protein interactions. The encoded protein is a microtubule-associated protein that has been shown to interact with receptor-interacting protein kinases and positively modulate signal transduction pathways converging on activation of the inducible transcription factor NF-kB. [provided by RefSeq, Jul 2008]
PHENOTYPE: Knockout mice are viable and grossly normal with no deficits in thymocytes, granulocytes, macrophages, NK cells or T- and B-cell subsets. Various signaling pathways mediating innate and adaptive immune responses appear unaltered. Mice are normally resistant to infection by a wide range of pathogens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932411E22Rik C T 11: 89,412,097 V32M probably benign Het
Abca15 T G 7: 120,374,965 I915S probably benign Het
Abcf2 CAT CATAAT 5: 24,576,591 probably benign Het
Ahdc1 T A 4: 133,061,451 M1K probably null Het
Akr1c12 T G 13: 4,272,356 D229A probably benign Het
C7 A T 15: 4,988,845 C839S probably damaging Het
Ccdc110 A G 8: 45,943,379 D769G probably damaging Het
Clk2 G T 3: 89,173,459 D251Y probably damaging Het
Dlx1 C A 2: 71,532,382 P211Q probably benign Het
Dock8 G A 19: 25,123,236 A703T probably benign Het
Eif2d T A 1: 131,158,251 L161Q probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Fndc3a T C 14: 72,552,519 I1079V probably benign Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gtf3c1 A G 7: 125,663,062 V1104A probably benign Het
H2-Ab1 A T 17: 34,264,842 Y59F probably damaging Het
Ints2 T C 11: 86,225,088 T772A probably damaging Het
Kcnh4 A G 11: 100,749,697 V501A probably benign Het
Ltbp1 A T 17: 75,179,189 T70S probably benign Het
Obox2 A G 7: 15,397,322 T118A probably benign Het
Olfr1048 T C 2: 86,236,572 M88V probably benign Het
Olfr599 C T 7: 103,338,267 T71I probably benign Het
Pih1d2 C T 9: 50,621,079 H146Y probably damaging Het
Pou2af1 C T 9: 51,233,005 S73F possibly damaging Het
Rnase2a T A 14: 51,255,639 I90L probably benign Het
S100a16 T A 3: 90,542,029 C4S probably benign Het
Sprr1a T C 3: 92,484,542 K51E possibly damaging Het
Tmem168 A T 6: 13,602,851 M172K probably damaging Het
Tnrc6b T C 15: 80,913,364 S1371P probably damaging Het
Trav21-dv12 T A 14: 53,876,053 L13* probably null Het
Vmn1r234 T A 17: 21,228,839 V5D probably benign Het
Vmn2r18 A G 5: 151,585,156 C168R probably damaging Het
Vmn2r90 C T 17: 17,728,096 P535S probably benign Het
Zfp595 A G 13: 67,316,700 C503R possibly damaging Het
Other mutations in Card6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00755:Card6 APN 15 5098941 missense possibly damaging 0.93
IGL01307:Card6 APN 15 5100002 missense possibly damaging 0.93
IGL02016:Card6 APN 15 5108256 missense probably damaging 1.00
IGL02976:Card6 APN 15 5099828 nonsense probably null
IGL03328:Card6 APN 15 5105445 splice site probably benign
IGL03356:Card6 APN 15 5100241 missense probably benign 0.00
Mark UTSW 15 5098691 small deletion probably benign
sharps UTSW 15 5099896 nonsense probably null
PIT4131001:Card6 UTSW 15 5108306 missense probably damaging 1.00
PIT4142001:Card6 UTSW 15 5098631 missense unknown
PIT4458001:Card6 UTSW 15 5098691 small deletion probably benign
R0562:Card6 UTSW 15 5105166 missense probably damaging 1.00
R0943:Card6 UTSW 15 5100286 missense probably damaging 1.00
R1654:Card6 UTSW 15 5098732 missense probably benign 0.00
R3892:Card6 UTSW 15 5099296 missense probably benign 0.01
R4408:Card6 UTSW 15 5101054 missense probably damaging 0.97
R4856:Card6 UTSW 15 5105141 splice site probably null
R4886:Card6 UTSW 15 5105141 splice site probably null
R4998:Card6 UTSW 15 5100082 missense probably benign 0.00
R5050:Card6 UTSW 15 5100376 missense probably benign 0.00
R5365:Card6 UTSW 15 5105406 missense possibly damaging 0.53
R5518:Card6 UTSW 15 5105214 missense probably damaging 0.99
R5686:Card6 UTSW 15 5100953 missense probably damaging 0.99
R6088:Card6 UTSW 15 5105019 missense possibly damaging 0.56
R6194:Card6 UTSW 15 5098444 missense unknown
R6336:Card6 UTSW 15 5099164 nonsense probably null
R6539:Card6 UTSW 15 5105391 missense probably damaging 0.99
R6560:Card6 UTSW 15 5098885 missense probably damaging 1.00
R7132:Card6 UTSW 15 5098691 small deletion probably benign
R7157:Card6 UTSW 15 5100109 missense probably benign 0.07
R7174:Card6 UTSW 15 5098691 small deletion probably benign
R7186:Card6 UTSW 15 5098691 small deletion probably benign
R7338:Card6 UTSW 15 5099872 missense probably benign 0.09
R7430:Card6 UTSW 15 5099200 missense probably benign 0.00
R7579:Card6 UTSW 15 5098691 small deletion probably benign
R7677:Card6 UTSW 15 5098444 missense unknown
R7718:Card6 UTSW 15 5099787 missense possibly damaging 0.54
R7720:Card6 UTSW 15 5098423 missense unknown
R7756:Card6 UTSW 15 5099896 nonsense probably null
R7758:Card6 UTSW 15 5099896 nonsense probably null
R7762:Card6 UTSW 15 5105338 missense probably benign
R7786:Card6 UTSW 15 5098691 small deletion probably benign
R7808:Card6 UTSW 15 5099472 missense probably benign 0.00
R7817:Card6 UTSW 15 5098691 small deletion probably benign
R7822:Card6 UTSW 15 5098865 missense possibly damaging 0.82
R7902:Card6 UTSW 15 5098691 small deletion probably benign
R7977:Card6 UTSW 15 5100525 missense probably damaging 1.00
R7987:Card6 UTSW 15 5100525 missense probably damaging 1.00
R8303:Card6 UTSW 15 5105365 missense probably benign 0.13
R8431:Card6 UTSW 15 5100276 missense probably damaging 0.98
R8691:Card6 UTSW 15 5099596 missense possibly damaging 0.76
RF013:Card6 UTSW 15 5100142 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TGGGTCTCGGTTGAAAAGGC -3'
(R):5'- TGCTAAACCTTCTCATCAGAATCC -3'

Sequencing Primer
(F):5'- GCCTTACACTGAGTAGACTGG -3'
(R):5'- TCAGAATCCCTCTCATGCTAAC -3'
Posted On2020-07-28