Incidental Mutation 'R8691:Card6'
ID668391
Institutional Source Beutler Lab
Gene Symbol Card6
Ensembl Gene ENSMUSG00000041849
Gene Namecaspase recruitment domain family, member 6
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8691 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location5095981-5108539 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5099596 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 773 (Y773N)
Ref Sequence ENSEMBL: ENSMUSP00000112833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118365]
Predicted Effect possibly damaging
Transcript: ENSMUST00000118365
AA Change: Y773N

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112833
Gene: ENSMUSG00000041849
AA Change: Y773N

DomainStartEndE-ValueType
CARD 3 89 2.13e-5 SMART
low complexity region 237 245 N/A INTRINSIC
low complexity region 257 273 N/A INTRINSIC
Blast:PGAM 278 656 7e-45 BLAST
low complexity region 919 935 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
internal_repeat_1 962 1041 6.5e-13 PROSPERO
internal_repeat_1 1039 1101 6.5e-13 PROSPERO
low complexity region 1107 1132 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a caspase recruitment domain (CARD), an antiparallel six-helical bundle that mediates homotypic protein-protein interactions. The encoded protein is a microtubule-associated protein that has been shown to interact with receptor-interacting protein kinases and positively modulate signal transduction pathways converging on activation of the inducible transcription factor NF-kB. [provided by RefSeq, Jul 2008]
PHENOTYPE: Knockout mice are viable and grossly normal with no deficits in thymocytes, granulocytes, macrophages, NK cells or T- and B-cell subsets. Various signaling pathways mediating innate and adaptive immune responses appear unaltered. Mice are normally resistant to infection by a wide range of pathogens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik G T 5: 30,105,289 A24E unknown Het
9530053A07Rik A T 7: 28,153,839 E1517V possibly damaging Het
Acap1 A G 11: 69,890,177 L117P probably damaging Het
Actl6b G A 5: 137,567,323 G394S probably damaging Het
Actr3b G T 5: 25,825,204 V177F possibly damaging Het
Adamts6 A G 13: 104,314,331 T341A probably benign Het
Agbl4 G T 4: 111,662,959 V474F probably benign Het
Bach1 T C 16: 87,719,629 S353P probably benign Het
C1qtnf9 G A 14: 60,779,692 D224N probably damaging Het
Camkmt A T 17: 85,113,832 N121Y probably damaging Het
Cbfa2t2 C A 2: 154,500,483 P40T possibly damaging Het
Colec10 A C 15: 54,435,024 E60D probably benign Het
Cspg4 T C 9: 56,892,996 V1647A probably benign Het
Cyp2d34 A G 15: 82,618,270 F222L probably benign Het
Dennd1b A T 1: 139,042,036 I97F possibly damaging Het
Deptor A C 15: 55,220,200 D388A possibly damaging Het
Dhx40 T C 11: 86,799,593 K201E possibly damaging Het
Diexf T C 1: 193,113,802 E673G probably benign Het
Dnah6 G A 6: 73,168,867 R854C probably damaging Het
Dock9 T C 14: 121,640,105 I409V possibly damaging Het
Esp31 G T 17: 38,644,701 L78F possibly damaging Het
Fam214a A T 9: 75,010,053 T652S probably benign Het
Fam98c A T 7: 29,153,464 V48E probably damaging Het
Fgfr1 A T 8: 25,562,237 D193V possibly damaging Het
Gm17078 A T 14: 51,611,236 F15I probably damaging Het
Gm6803 T G 12: 88,018,508 K88N probably damaging Het
Grid2 G T 6: 63,503,337 R45L probably damaging Het
Hecw2 A G 1: 53,865,064 V1175A probably benign Het
Hspa1b T C 17: 34,957,096 I638V possibly damaging Het
Ighv6-7 A G 12: 114,455,684 V100A probably benign Het
Itch G T 2: 155,210,558 E693* probably null Het
Ivl G A 3: 92,571,516 S414L unknown Het
Kif5b T A 18: 6,225,787 N160I probably benign Het
Lpin1 C T 12: 16,573,659 probably benign Het
Malsu1 C A 6: 49,075,237 H130Q probably benign Het
Naip2 A C 13: 100,161,168 L787V probably damaging Het
Nynrin C T 14: 55,872,649 R1738W probably damaging Het
Olfr1508 A T 14: 52,463,901 I36N possibly damaging Het
Olfr557 C T 7: 102,698,570 Q111* probably null Het
Olfr743 A G 14: 50,533,453 T14A probably benign Het
Olfr872 T A 9: 20,260,451 S204T probably benign Het
Pclo A G 5: 14,521,692 T364A unknown Het
Phlda2 A C 7: 143,502,469 S8A probably benign Het
Pou3f1 G A 4: 124,657,756 G17E unknown Het
Ppfibp2 A G 7: 107,747,578 D899G probably damaging Het
Pskh1 T C 8: 105,913,201 V171A probably damaging Het
Rictor A G 15: 6,787,032 T1262A probably damaging Het
Rnf41 T C 10: 128,438,208 V243A probably benign Het
Slc9c1 T A 16: 45,606,819 N1162K probably benign Het
Spef2 A T 15: 9,601,919 L1419* probably null Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tnc A G 4: 63,962,076 C1954R probably damaging Het
Ttll11 T A 2: 35,784,149 I622F probably damaging Het
Vmn2r104 A G 17: 20,041,848 I340T probably damaging Het
Vmn2r110 G T 17: 20,583,142 D390E probably benign Het
Other mutations in Card6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00755:Card6 APN 15 5098941 missense possibly damaging 0.93
IGL01307:Card6 APN 15 5100002 missense possibly damaging 0.93
IGL02016:Card6 APN 15 5108256 missense probably damaging 1.00
IGL02976:Card6 APN 15 5099828 nonsense probably null
IGL03328:Card6 APN 15 5105445 splice site probably benign
IGL03356:Card6 APN 15 5100241 missense probably benign 0.00
Mark UTSW 15 5098691 small deletion probably benign
sharps UTSW 15 5099896 nonsense probably null
PIT4131001:Card6 UTSW 15 5108306 missense probably damaging 1.00
PIT4142001:Card6 UTSW 15 5098631 missense unknown
PIT4458001:Card6 UTSW 15 5098691 small deletion probably benign
R0562:Card6 UTSW 15 5105166 missense probably damaging 1.00
R0943:Card6 UTSW 15 5100286 missense probably damaging 1.00
R1654:Card6 UTSW 15 5098732 missense probably benign 0.00
R3892:Card6 UTSW 15 5099296 missense probably benign 0.01
R4408:Card6 UTSW 15 5101054 missense probably damaging 0.97
R4856:Card6 UTSW 15 5105141 splice site probably null
R4886:Card6 UTSW 15 5105141 splice site probably null
R4998:Card6 UTSW 15 5100082 missense probably benign 0.00
R5050:Card6 UTSW 15 5100376 missense probably benign 0.00
R5365:Card6 UTSW 15 5105406 missense possibly damaging 0.53
R5518:Card6 UTSW 15 5105214 missense probably damaging 0.99
R5686:Card6 UTSW 15 5100953 missense probably damaging 0.99
R6088:Card6 UTSW 15 5105019 missense possibly damaging 0.56
R6194:Card6 UTSW 15 5098444 missense unknown
R6336:Card6 UTSW 15 5099164 nonsense probably null
R6539:Card6 UTSW 15 5105391 missense probably damaging 0.99
R6560:Card6 UTSW 15 5098885 missense probably damaging 1.00
R7132:Card6 UTSW 15 5098691 small deletion probably benign
R7157:Card6 UTSW 15 5100109 missense probably benign 0.07
R7174:Card6 UTSW 15 5098691 small deletion probably benign
R7186:Card6 UTSW 15 5098691 small deletion probably benign
R7338:Card6 UTSW 15 5099872 missense probably benign 0.09
R7430:Card6 UTSW 15 5099200 missense probably benign 0.00
R7579:Card6 UTSW 15 5098691 small deletion probably benign
R7677:Card6 UTSW 15 5098444 missense unknown
R7718:Card6 UTSW 15 5099787 missense possibly damaging 0.54
R7720:Card6 UTSW 15 5098423 missense unknown
R7756:Card6 UTSW 15 5099896 nonsense probably null
R7758:Card6 UTSW 15 5099896 nonsense probably null
R7762:Card6 UTSW 15 5105338 missense probably benign
R7786:Card6 UTSW 15 5098691 small deletion probably benign
R7808:Card6 UTSW 15 5099472 missense probably benign 0.00
R7817:Card6 UTSW 15 5098691 small deletion probably benign
R7822:Card6 UTSW 15 5098865 missense possibly damaging 0.82
R7902:Card6 UTSW 15 5098691 small deletion probably benign
R7977:Card6 UTSW 15 5100525 missense probably damaging 1.00
R7987:Card6 UTSW 15 5100525 missense probably damaging 1.00
R8295:Card6 UTSW 15 5098691 small deletion probably benign
R8303:Card6 UTSW 15 5105365 missense probably benign 0.13
R8431:Card6 UTSW 15 5100276 missense probably damaging 0.98
RF013:Card6 UTSW 15 5100142 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TTGTGAGCCAAGAGAACGTCC -3'
(R):5'- TCATGCCTTATCCAGCACAC -3'

Sequencing Primer
(F):5'- GTGACCTACTCGAGAGACCACTG -3'
(R):5'- AGCACACCCATGGCCCTTG -3'
Posted On2021-04-30