Incidental Mutation 'BB020:Slc6a1'
ID643119
Institutional Source Beutler Lab
Gene Symbol Slc6a1
Ensembl Gene ENSMUSG00000030310
Gene Namesolute carrier family 6 (neurotransmitter transporter, GABA), member 1
SynonymsGat1, XT-1, Xtrp1, GAT-1, Gabt1, Gabt
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #BB020
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location114282635-114317532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 114311898 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 473 (W473R)
Ref Sequence ENSEMBL: ENSMUSP00000032454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032454] [ENSMUST00000204074]
Predicted Effect probably damaging
Transcript: ENSMUST00000032454
AA Change: W473R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032454
Gene: ENSMUSG00000030310
AA Change: W473R

DomainStartEndE-ValueType
Pfam:SNF 44 559 6.1e-235 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204074
AA Change: W289R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145080
Gene: ENSMUSG00000030310
AA Change: W289R

DomainStartEndE-ValueType
Pfam:SNF 1 375 1.2e-162 PFAM
Meta Mutation Damage Score 0.9608 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a gamma-aminobutyric acid (GABA) transporter that localizes to the plasma membrane. The encoded protein removes GABA from the synaptic cleft, restoring it to presynaptic terminals. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous hypomorphic mice display abnormal inhibitory postsynaptic currents, and abnormal GABA uptake and release. Null mice show hyperactivity and various behavioral abnormalities, as well as an aversion to bitter taste. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,751 L85P probably damaging Het
4933414I15Rik A G 11: 50,942,400 V125A unknown Het
Adam34 T A 8: 43,650,874 H578L probably damaging Het
Ago4 A T 4: 126,507,018 M678K probably benign Het
Atrn T C 2: 130,995,066 L1150P probably damaging Het
Camta1 C T 4: 151,083,757 E279K probably damaging Het
Ccdc88c T C 12: 100,945,490 D695G possibly damaging Het
Col11a2 A T 17: 34,056,055 K400* probably null Het
Cpsf4 T A 5: 145,167,358 M1K probably null Het
Dnah12 A T 14: 26,766,115 Q992L probably benign Het
Dnajc7 T C 11: 100,596,212 Y145C probably damaging Het
Eml5 A T 12: 98,844,020 D892E possibly damaging Het
Fam193a A G 5: 34,466,195 K23E possibly damaging Het
Fam214b A T 4: 43,035,919 C271S probably benign Het
Filip1 T G 9: 79,820,047 K430T possibly damaging Het
Gm5089 T C 14: 122,435,991 D106G unknown Het
Hip1 A T 5: 135,460,456 N45K probably damaging Het
Hivep2 T C 10: 14,127,837 S60P probably damaging Het
Ighv1-53 A T 12: 115,158,409 C115* probably null Het
Macf1 T C 4: 123,409,651 T353A probably benign Het
Mast3 A T 8: 70,786,635 V433E probably damaging Het
Mast4 A T 13: 102,772,563 M660K probably damaging Het
Nr2e1 T C 10: 42,563,383 Y380C probably damaging Het
Olfr1465 T A 19: 13,314,205 M27L probably benign Het
Otog A G 7: 46,310,147 D720G probably damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Sprr3 T C 3: 92,457,208 I110V possibly damaging Het
Ston1 A G 17: 88,636,144 E326G probably benign Het
Tapbpl T G 6: 125,230,270 Q152P probably damaging Het
Tectb C T 19: 55,194,673 L319F possibly damaging Het
Tpp2 G A 1: 43,960,961 G413D probably damaging Het
Tpsg1 A G 17: 25,373,204 H84R probably damaging Het
Usp24 A G 4: 106,428,489 N2437S probably benign Het
Usp32 T C 11: 85,007,059 Q1152R probably damaging Het
Vmn2r6 T C 3: 64,559,803 T92A probably benign Het
Xpo7 A G 14: 70,707,348 V35A probably benign Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zfp169 A G 13: 48,490,481 V390A unknown Het
Other mutations in Slc6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Slc6a1 APN 6 114314465 splice site probably null
IGL01604:Slc6a1 APN 6 114314401 missense probably damaging 1.00
IGL02004:Slc6a1 APN 6 114314325 missense probably benign 0.35
IGL02437:Slc6a1 APN 6 114308617 missense probably damaging 1.00
IGL02553:Slc6a1 APN 6 114302490 intron probably benign
lewis UTSW 6 114307770 missense probably damaging 1.00
phytotoxin UTSW 6 114311898 missense probably damaging 1.00
sponges UTSW 6 114302800 missense probably benign 0.13
BB008:Slc6a1 UTSW 6 114311902 missense probably benign 0.00
BB010:Slc6a1 UTSW 6 114311898 missense probably damaging 1.00
BB018:Slc6a1 UTSW 6 114311902 missense probably benign 0.00
R0178:Slc6a1 UTSW 6 114304852 missense possibly damaging 0.82
R0238:Slc6a1 UTSW 6 114302800 missense probably benign 0.13
R0238:Slc6a1 UTSW 6 114302800 missense probably benign 0.13
R0239:Slc6a1 UTSW 6 114302800 missense probably benign 0.13
R0239:Slc6a1 UTSW 6 114302800 missense probably benign 0.13
R0408:Slc6a1 UTSW 6 114302800 missense probably benign 0.13
R1165:Slc6a1 UTSW 6 114311829 missense probably damaging 1.00
R1451:Slc6a1 UTSW 6 114307795 nonsense probably null
R1535:Slc6a1 UTSW 6 114307770 missense probably damaging 1.00
R1568:Slc6a1 UTSW 6 114307770 missense probably damaging 1.00
R1900:Slc6a1 UTSW 6 114311854 missense possibly damaging 0.50
R2011:Slc6a1 UTSW 6 114307770 missense probably damaging 1.00
R2134:Slc6a1 UTSW 6 114302016 missense probably benign
R2139:Slc6a1 UTSW 6 114304061 missense possibly damaging 0.77
R2152:Slc6a1 UTSW 6 114307770 missense probably damaging 1.00
R2154:Slc6a1 UTSW 6 114307770 missense probably damaging 1.00
R2207:Slc6a1 UTSW 6 114308671 missense probably damaging 1.00
R4627:Slc6a1 UTSW 6 114308106 missense probably benign
R4690:Slc6a1 UTSW 6 114302831 missense probably damaging 0.99
R4706:Slc6a1 UTSW 6 114307752 missense possibly damaging 0.95
R4886:Slc6a1 UTSW 6 114302533 missense possibly damaging 0.94
R4974:Slc6a1 UTSW 6 114307701 missense probably damaging 0.97
R5219:Slc6a1 UTSW 6 114310221 missense probably benign 0.18
R5354:Slc6a1 UTSW 6 114302623 missense possibly damaging 0.46
R5361:Slc6a1 UTSW 6 114302532 missense probably benign 0.00
R6448:Slc6a1 UTSW 6 114302086 missense possibly damaging 0.82
R6678:Slc6a1 UTSW 6 114307776 missense probably benign 0.00
R6941:Slc6a1 UTSW 6 114313512 nonsense probably null
R7347:Slc6a1 UTSW 6 114311818 missense probably damaging 0.99
R7811:Slc6a1 UTSW 6 114302554 missense probably damaging 1.00
R7931:Slc6a1 UTSW 6 114311902 missense probably benign 0.00
R7933:Slc6a1 UTSW 6 114311898 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCACTGTGCCCTGAAGC -3'
(R):5'- ATGAACATCTATGACTCTCCCTG -3'

Sequencing Primer
(F):5'- GCTATGTGTCTAGTGCCAGCC -3'
(R):5'- TGTCACACTTCCTCGACAGGG -3'
Posted On2020-08-01