Incidental Mutation 'R8337:Olfr635'
ID644672
Institutional Source Beutler Lab
Gene Symbol Olfr635
Ensembl Gene ENSMUSG00000094520
Gene Nameolfactory receptor 635
SynonymsGA_x6K02T2PBJ9-6713641-6714588, MOR5-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R8337 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location103971152-103987540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 103979374 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 61 (M61L)
Ref Sequence ENSEMBL: ENSMUSP00000148103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098185] [ENSMUST00000209473]
Predicted Effect probably damaging
Transcript: ENSMUST00000098185
AA Change: M67L

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095788
Gene: ENSMUSG00000094520
AA Change: M67L

DomainStartEndE-ValueType
Pfam:7tm_4 39 318 1.2e-119 PFAM
Pfam:7TM_GPCR_Srsx 43 182 1.3e-9 PFAM
Pfam:7tm_1 49 300 1.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209473
AA Change: M61L

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik T C 16: 88,759,263 Y122H probably damaging Het
Abhd14b T A 9: 106,450,041 H7Q probably benign Het
Acod1 C T 14: 103,049,344 R28W possibly damaging Het
Agap2 A G 10: 127,088,325 T803A unknown Het
Angptl7 T C 4: 148,497,284 E215G probably damaging Het
Ankrd34c T A 9: 89,729,898 D130V probably damaging Het
BC028528 A G 3: 95,884,986 V144A probably benign Het
Cab39l T C 14: 59,539,191 F274L probably damaging Het
Cdsn T C 17: 35,555,518 S315P possibly damaging Het
Celsr3 CGGGG CGGGGG 9: 108,841,272 probably null Het
Cep97 A T 16: 55,915,031 L540* probably null Het
Chrna2 G T 14: 66,149,568 E388* probably null Het
Ckap4 A G 10: 84,528,596 V201A probably damaging Het
Clec4b1 A G 6: 123,065,963 K47R probably benign Het
Clvs2 A T 10: 33,528,488 I244N possibly damaging Het
Cmtr1 G A 17: 29,674,177 E57K probably benign Het
Cxxc1 T A 18: 74,220,839 D565E possibly damaging Het
Dpcr1 T C 17: 35,637,594 H371R possibly damaging Het
Dtx3l T A 16: 35,933,703 M178L probably benign Het
Eml2 A G 7: 19,196,236 D294G possibly damaging Het
Flt3 A G 5: 147,332,888 probably null Het
Frs3 T A 17: 47,703,852 L490Q probably damaging Het
Gm14085 C T 2: 122,525,136 T603I probably benign Het
Gm35339 T C 15: 76,361,484 V1307A Het
Gm6882 G A 7: 21,427,634 T103I possibly damaging Het
Gsdmd C T 15: 75,864,421 T133I probably benign Het
Hhipl2 C A 1: 183,428,632 C331* probably null Het
Ifnar1 C A 16: 91,505,336 D566E possibly damaging Het
Ighv1-34 A T 12: 114,851,319 N74K probably benign Het
Kdm7a T C 6: 39,145,527 D801G probably benign Het
March1 T C 8: 66,418,989 L139P probably damaging Het
Metap1d T C 2: 71,515,638 V181A probably damaging Het
Mfsd8 G A 3: 40,835,193 R140C probably damaging Het
Mrps25 T C 6: 92,175,764 T92A probably benign Het
Ntng2 C A 2: 29,248,038 M1I probably null Het
Olfr64 C T 7: 103,893,049 G229R probably benign Het
Olfr983 T C 9: 40,092,399 K189R probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pla2g12a A G 3: 129,878,816 D33G probably damaging Het
Prlhr A G 19: 60,467,846 V94A possibly damaging Het
Ralgapb T A 2: 158,450,272 S793T probably benign Het
Rapgef6 T A 11: 54,631,301 L455* probably null Het
Sbf2 T C 7: 110,441,462 H386R probably benign Het
Sec23ip C A 7: 128,764,025 N539K probably damaging Het
Shisa4 A G 1: 135,373,169 L121P probably damaging Het
Stard9 T A 2: 120,679,825 F296I probably damaging Het
Strn3 T C 12: 51,661,172 K147E probably damaging Het
Taf5l T C 8: 123,998,102 N326S probably benign Het
Tfb2m T A 1: 179,542,349 I170L probably benign Het
Tfec T C 6: 16,845,423 N79S possibly damaging Het
Tnn C T 1: 160,118,483 G922R probably damaging Het
Tox3 T C 8: 90,347,879 Y24C probably damaging Het
Vmn2r6 A T 3: 64,556,105 L436* probably null Het
Vmn2r80 A G 10: 79,148,873 I20V probably benign Het
Other mutations in Olfr635
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Olfr635 APN 7 103979792 missense probably benign 0.09
IGL01330:Olfr635 APN 7 103980142 utr 3 prime probably benign
IGL01433:Olfr635 APN 7 103979332 missense probably damaging 1.00
FR4304:Olfr635 UTSW 7 103979903 frame shift probably null
FR4340:Olfr635 UTSW 7 103979903 frame shift probably null
FR4342:Olfr635 UTSW 7 103979903 frame shift probably null
R0271:Olfr635 UTSW 7 103979630 missense possibly damaging 0.83
R1909:Olfr635 UTSW 7 103979790 nonsense probably null
R2212:Olfr635 UTSW 7 103979402 missense probably damaging 0.98
R2484:Olfr635 UTSW 7 103979338 missense probably benign
R3412:Olfr635 UTSW 7 103979402 missense probably damaging 0.98
R4513:Olfr635 UTSW 7 103979441 missense probably benign 0.03
R4559:Olfr635 UTSW 7 103979560 missense probably damaging 1.00
R5032:Olfr635 UTSW 7 103979374 missense probably damaging 0.98
R5436:Olfr635 UTSW 7 103979266 missense probably benign
R5591:Olfr635 UTSW 7 103980113 missense probably benign 0.00
R5617:Olfr635 UTSW 7 103979714 missense possibly damaging 0.91
R5911:Olfr635 UTSW 7 103979708 missense probably benign
R6249:Olfr635 UTSW 7 103979611 missense possibly damaging 0.85
R6275:Olfr635 UTSW 7 103979974 missense probably damaging 1.00
R6806:Olfr635 UTSW 7 103979564 missense possibly damaging 0.72
R7589:Olfr635 UTSW 7 103979791 missense probably damaging 1.00
R8188:Olfr635 UTSW 7 103979536 missense probably damaging 1.00
RF004:Olfr635 UTSW 7 103979903 frame shift probably null
RF005:Olfr635 UTSW 7 103979561 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCCATCAAGTATGTCAGAAG -3'
(R):5'- ACAGATGGCCACATAACGGTC -3'

Sequencing Primer
(F):5'- TCAAGTATGTCAGAAGTAACAAACAC -3'
(R):5'- CATAACGGTCAAAGGACATGGCC -3'
Posted On2020-09-02