Incidental Mutation 'R8370:Prss58'
ID646340
Institutional Source Beutler Lab
Gene Symbol Prss58
Ensembl Gene ENSMUSG00000051936
Gene Nameprotease, serine 58
SynonymsBC048599
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R8370 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location40895270-40900387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 40895424 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 222 (G222C)
Ref Sequence ENSEMBL: ENSMUSP00000069833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063523] [ENSMUST00000103262]
Predicted Effect probably damaging
Transcript: ENSMUST00000063523
AA Change: G222C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069833
Gene: ENSMUSG00000051936
AA Change: G222C

DomainStartEndE-ValueType
Tryp_SPc 22 234 4.49e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103262
SMART Domains Protein: ENSMUSP00000100078
Gene: ENSMUSG00000076461

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:V-set 22 116 8.4e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trypsin family of serine proteases. This gene and several related trypsinogen genes are localized to the T cell receptor beta locus on chromosome 7. This gene was previously described as a trypsinogen-like pseudogene, but it is now thought to be a protein-coding gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,743,952 D18G probably benign Het
4921530L21Rik T C 14: 95,882,494 L229P probably damaging Het
Adamts5 A G 16: 85,899,993 V92A possibly damaging Het
Armc2 T A 10: 41,923,837 N675I possibly damaging Het
Cav1 A G 6: 17,339,294 H126R possibly damaging Het
Clca4b A G 3: 144,926,063 F227S probably damaging Het
Clec4a4 G A 6: 122,991,799 G41D probably damaging Het
Commd1 A T 11: 22,982,104 L51Q probably damaging Het
Dhx57 A T 17: 80,245,763 V1245D probably damaging Het
Ephb2 A G 4: 136,655,991 I925T possibly damaging Het
Eprs T A 1: 185,399,257 I700K probably damaging Het
Fry C A 5: 150,395,819 T983K probably damaging Het
Gm14325 T C 2: 177,832,592 I232M probably benign Het
Golgb1 A G 16: 36,912,317 H683R probably benign Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Kif9 C T 9: 110,488,613 R113C probably damaging Het
Klhl33 C T 14: 50,892,232 R312Q probably damaging Het
Lama5 T C 2: 180,201,487 E489G possibly damaging Het
Lhb A G 7: 45,421,642 D97G probably damaging Het
Lrp1b T C 2: 40,998,105 D2381G Het
Miga2 AAGAG AAG 2: 30,375,743 probably null Het
Mmp17 A G 5: 129,605,578 D427G probably damaging Het
Mrps18b T C 17: 35,912,362 I131V probably benign Het
Nav1 T A 1: 135,471,144 K567* probably null Het
Ncam1 T A 9: 49,557,131 R343* probably null Het
Nfrkb T A 9: 31,405,579 N591K probably damaging Het
Numb A T 12: 83,808,200 C117* probably null Het
Olfr1487 T A 19: 13,619,297 I2N probably damaging Het
Olfr522 A T 7: 140,162,768 Y61N probably damaging Het
Pfpl A T 19: 12,429,911 N509Y probably damaging Het
Ptx4 C A 17: 25,123,340 P263Q possibly damaging Het
Ribc2 T G 15: 85,143,288 H323Q probably benign Het
Rsf1 CGGCGGC CGGCGGCGGGGGCGGC 7: 97,579,929 probably benign Het
Smchd1 G A 17: 71,394,913 T1028M probably benign Het
Srebf1 T C 11: 60,202,196 I806V probably benign Het
Trim14 A T 4: 46,523,711 L109Q probably damaging Het
Wdfy4 A T 14: 33,093,251 H1602Q Het
Zbtb48 A G 4: 152,021,287 probably null Het
Zranb3 T C 1: 127,967,933 E726G probably benign Het
Other mutations in Prss58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Prss58 APN 6 40895465 missense probably damaging 1.00
IGL01108:Prss58 APN 6 40897344 missense probably damaging 1.00
IGL01645:Prss58 APN 6 40897310 missense probably damaging 0.98
R0032:Prss58 UTSW 6 40895699 missense probably benign 0.00
R0032:Prss58 UTSW 6 40895699 missense probably benign 0.00
R1622:Prss58 UTSW 6 40897314 missense possibly damaging 0.84
R2511:Prss58 UTSW 6 40897800 missense probably damaging 1.00
R4292:Prss58 UTSW 6 40897310 missense probably damaging 0.98
R5093:Prss58 UTSW 6 40897817 missense probably damaging 1.00
R5601:Prss58 UTSW 6 40897849 missense possibly damaging 0.92
R5992:Prss58 UTSW 6 40897769 missense probably damaging 1.00
R6806:Prss58 UTSW 6 40897732 missense probably damaging 0.98
R7105:Prss58 UTSW 6 40897766 missense probably damaging 1.00
R7136:Prss58 UTSW 6 40900053 critical splice donor site probably null
R7344:Prss58 UTSW 6 40895465 missense probably damaging 1.00
R7699:Prss58 UTSW 6 40895388 missense probably damaging 1.00
R7700:Prss58 UTSW 6 40895388 missense probably damaging 1.00
R7954:Prss58 UTSW 6 40895609 missense possibly damaging 0.92
R8305:Prss58 UTSW 6 40895660 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACTGACTCCACAGACGTGAG -3'
(R):5'- AGAAAACATGATCTGCGTAGGC -3'

Sequencing Primer
(F):5'- ACAGACGTGAGCCGGTGTG -3'
(R):5'- GGAGGCTGCCTTGCAAG -3'
Posted On2020-09-02