Incidental Mutation 'R8376:Vmn1r55'
ID 646676
Institutional Source Beutler Lab
Gene Symbol Vmn1r55
Ensembl Gene ENSMUSG00000074402
Gene Name vomeronasal 1 receptor 55
Synonyms LOC236535, LOC384522, V1rd5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R8376 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 5146218-5147501 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 5146870 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 185 (I185L)
Ref Sequence ENSEMBL: ENSMUSP00000096443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098844]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000098844
AA Change: I185L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000096443
Gene: ENSMUSG00000074402
AA Change: I185L

DomainStartEndE-ValueType
Pfam:TAS2R 1 286 3.7e-14 PFAM
Pfam:7tm_1 20 279 4e-8 PFAM
Pfam:V1R 31 286 5.5e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Adam32 A C 8: 24,919,920 I173S possibly damaging Het
Ahctf1 T C 1: 179,782,955 D599G probably damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Ankrd40 G T 11: 94,334,836 G231V probably damaging Het
Apba2 T A 7: 64,695,593 V177D probably benign Het
Atp12a G T 14: 56,374,626 probably null Het
Birc6 C T 17: 74,589,640 T1027M probably benign Het
Bmpr2 G A 1: 59,867,356 R536H probably damaging Het
Brms1l C A 12: 55,841,629 N67K probably benign Het
Cachd1 G A 4: 100,974,876 R745H probably damaging Het
Cacnb4 G A 2: 52,464,653 Q238* probably null Het
Cdc42 G A 4: 137,328,894 T102I probably benign Het
Cfhr1 A C 1: 139,547,811 C307W unknown Het
Ddb1 G A 19: 10,619,305 V463M probably damaging Het
Dhx30 G A 9: 110,088,639 R365C probably benign Het
Dnah1 A G 14: 31,301,346 F1005L probably damaging Het
Elp4 A G 2: 105,842,308 V144A probably benign Het
Enpp2 T A 15: 54,910,095 N77Y probably damaging Het
Fsip1 C T 2: 118,233,038 V317I possibly damaging Het
Gc G A 5: 89,438,259 Q341* probably null Het
Gpt2 A T 8: 85,493,065 I47F probably benign Het
Ino80 A T 2: 119,442,487 S503T probably benign Het
Kcnn4 C A 7: 24,377,626 T200K possibly damaging Het
Krtap4-7 A G 11: 99,643,927 S37P unknown Het
Lrrc4b T C 7: 44,462,594 V630A probably benign Het
Man2a2 C T 7: 80,360,923 W773* probably null Het
Mgrn1 T A 16: 4,915,766 L192Q probably damaging Het
Mtx1 A G 3: 89,214,171 V52A probably benign Het
Myc A T 15: 61,987,546 N24Y possibly damaging Het
Nbea G A 3: 55,643,655 S2696L possibly damaging Het
Nox4 A G 7: 87,374,384 N493D probably damaging Het
Olfr692 C A 7: 105,368,640 P105T probably benign Het
Osbpl10 G A 9: 115,223,593 G403D probably damaging Het
Pdcd6ip A T 9: 113,689,616 L192Q probably damaging Het
Pde3a A G 6: 141,481,221 I703V possibly damaging Het
Pkd1l3 CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA 8: 109,623,788 probably benign Het
Plcb3 A G 19: 6,966,703 S36P probably damaging Het
Plk5 T C 10: 80,360,345 F279L probably damaging Het
Prl7a1 T G 13: 27,637,655 E99D probably benign Het
Rnf4 C T 5: 34,351,357 R188W probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGAGGCGGCGG 7: 97,579,917 probably benign Het
Scel A G 14: 103,572,015 S264G probably benign Het
Sdk1 A G 5: 142,158,621 Q1712R possibly damaging Het
Slc15a1 A G 14: 121,480,703 Y255H probably benign Het
Syne1 C T 10: 5,043,615 G525D probably benign Het
Taldo1 T C 7: 141,401,875 V214A probably damaging Het
Tbc1d12 A G 19: 38,901,409 T428A probably damaging Het
Tlr6 T C 5: 64,955,112 K151E probably benign Het
Ubr2 T A 17: 46,942,795 D1468V probably benign Het
Ubtf A C 11: 102,308,911 Y463D probably damaging Het
Uroc1 A T 6: 90,337,715 M106L probably damaging Het
Vmn2r93 T A 17: 18,304,968 V296D probably damaging Het
Zfp65 A C 13: 67,708,918 Y81D probably damaging Het
Zw10 A T 9: 49,077,483 Y683F possibly damaging Het
Other mutations in Vmn1r55
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1771:Vmn1r55 UTSW 7 5146920 missense probably benign 0.01
R2063:Vmn1r55 UTSW 7 5147049 missense possibly damaging 0.91
R2064:Vmn1r55 UTSW 7 5147049 missense possibly damaging 0.91
R2066:Vmn1r55 UTSW 7 5147049 missense possibly damaging 0.91
R2068:Vmn1r55 UTSW 7 5147049 missense possibly damaging 0.91
R3737:Vmn1r55 UTSW 7 5147196 missense probably damaging 0.99
R4409:Vmn1r55 UTSW 7 5147076 missense probably benign 0.40
R4410:Vmn1r55 UTSW 7 5147076 missense probably benign 0.40
R4700:Vmn1r55 UTSW 7 5146587 missense probably damaging 1.00
R4700:Vmn1r55 UTSW 7 5146588 missense probably damaging 0.98
R4755:Vmn1r55 UTSW 7 5147026 missense probably damaging 1.00
R4945:Vmn1r55 UTSW 7 5147106 missense probably damaging 1.00
R5064:Vmn1r55 UTSW 7 5146929 missense probably benign 0.00
R5186:Vmn1r55 UTSW 7 5146986 missense probably damaging 0.99
R5394:Vmn1r55 UTSW 7 5146996 missense probably damaging 1.00
R6487:Vmn1r55 UTSW 7 5146555 missense probably benign 0.23
R7855:Vmn1r55 UTSW 7 5146624 missense probably benign
R8204:Vmn1r55 UTSW 7 5147286 missense possibly damaging 0.48
R9586:Vmn1r55 UTSW 7 5146771 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCGCCGAGATTCCACAAAG -3'
(R):5'- GAGATACTCTTGTTACAGTTGCTG -3'

Sequencing Primer
(F):5'- TCCACAAAGGAAACGTGAAATAAAAC -3'
(R):5'- GGTTGTTCAGTGTGTTAAATAATGC -3'
Posted On 2020-09-02